ID: 1016769745 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:147835806-147835828 |
Sequence | CTGGAGACAAGGAGGTGATG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1016769745_1016769753 | 28 | Left | 1016769745 | 6:147835806-147835828 | CCGCATCACCTCCTTGTCTCCAG | No data | ||
Right | 1016769753 | 6:147835857-147835879 | CAGATTTTCCTTCGTGACTGAGG | No data | ||||
1016769745_1016769748 | -8 | Left | 1016769745 | 6:147835806-147835828 | CCGCATCACCTCCTTGTCTCCAG | No data | ||
Right | 1016769748 | 6:147835821-147835843 | GTCTCCAGCTCTCTCTAGATAGG | No data | ||||
1016769745_1016769750 | 2 | Left | 1016769745 | 6:147835806-147835828 | CCGCATCACCTCCTTGTCTCCAG | No data | ||
Right | 1016769750 | 6:147835831-147835853 | CTCTCTAGATAGGTCCTCTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1016769745 | Original CRISPR | CTGGAGACAAGGAGGTGATG CGG (reversed) | Intergenic | ||
No off target data available for this crispr |