ID: 1016769745

View in Genome Browser
Species Human (GRCh38)
Location 6:147835806-147835828
Sequence CTGGAGACAAGGAGGTGATG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016769745_1016769753 28 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data
1016769745_1016769748 -8 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769745_1016769750 2 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016769745 Original CRISPR CTGGAGACAAGGAGGTGATG CGG (reversed) Intergenic
No off target data available for this crispr