ID: 1016769748

View in Genome Browser
Species Human (GRCh38)
Location 6:147835821-147835843
Sequence GTCTCCAGCTCTCTCTAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016769742_1016769748 5 Left 1016769742 6:147835793-147835815 CCTCCAGAAGGACCCGCATCACC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769737_1016769748 29 Left 1016769737 6:147835769-147835791 CCCCTCCACTTGTCTTGGGCAGC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769740_1016769748 24 Left 1016769740 6:147835774-147835796 CCACTTGTCTTGGGCAGCACCTC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769744_1016769748 -7 Left 1016769744 6:147835805-147835827 CCCGCATCACCTCCTTGTCTCCA No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769738_1016769748 28 Left 1016769738 6:147835770-147835792 CCCTCCACTTGTCTTGGGCAGCA No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769739_1016769748 27 Left 1016769739 6:147835771-147835793 CCTCCACTTGTCTTGGGCAGCAC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769745_1016769748 -8 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data
1016769743_1016769748 2 Left 1016769743 6:147835796-147835818 CCAGAAGGACCCGCATCACCTCC No data
Right 1016769748 6:147835821-147835843 GTCTCCAGCTCTCTCTAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016769748 Original CRISPR GTCTCCAGCTCTCTCTAGAT AGG Intergenic
No off target data available for this crispr