ID: 1016769750

View in Genome Browser
Species Human (GRCh38)
Location 6:147835831-147835853
Sequence CTCTCTAGATAGGTCCTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016769742_1016769750 15 Left 1016769742 6:147835793-147835815 CCTCCAGAAGGACCCGCATCACC No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769743_1016769750 12 Left 1016769743 6:147835796-147835818 CCAGAAGGACCCGCATCACCTCC No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769744_1016769750 3 Left 1016769744 6:147835805-147835827 CCCGCATCACCTCCTTGTCTCCA No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769745_1016769750 2 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769747_1016769750 -9 Left 1016769747 6:147835817-147835839 CCTTGTCTCCAGCTCTCTCTAGA No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data
1016769746_1016769750 -6 Left 1016769746 6:147835814-147835836 CCTCCTTGTCTCCAGCTCTCTCT No data
Right 1016769750 6:147835831-147835853 CTCTCTAGATAGGTCCTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016769750 Original CRISPR CTCTCTAGATAGGTCCTCTA AGG Intergenic
No off target data available for this crispr