ID: 1016769753

View in Genome Browser
Species Human (GRCh38)
Location 6:147835857-147835879
Sequence CAGATTTTCCTTCGTGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016769745_1016769753 28 Left 1016769745 6:147835806-147835828 CCGCATCACCTCCTTGTCTCCAG No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data
1016769747_1016769753 17 Left 1016769747 6:147835817-147835839 CCTTGTCTCCAGCTCTCTCTAGA No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data
1016769749_1016769753 9 Left 1016769749 6:147835825-147835847 CCAGCTCTCTCTAGATAGGTCCT No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data
1016769744_1016769753 29 Left 1016769744 6:147835805-147835827 CCCGCATCACCTCCTTGTCTCCA No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data
1016769746_1016769753 20 Left 1016769746 6:147835814-147835836 CCTCCTTGTCTCCAGCTCTCTCT No data
Right 1016769753 6:147835857-147835879 CAGATTTTCCTTCGTGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016769753 Original CRISPR CAGATTTTCCTTCGTGACTG AGG Intergenic
No off target data available for this crispr