ID: 1016776390

View in Genome Browser
Species Human (GRCh38)
Location 6:147909214-147909236
Sequence AACTAGGCCTTGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016776379_1016776390 24 Left 1016776379 6:147909167-147909189 CCACCACACGCCAGCCTAGGCTG No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data
1016776382_1016776390 14 Left 1016776382 6:147909177-147909199 CCAGCCTAGGCTGGAGACCCTGC No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data
1016776381_1016776390 21 Left 1016776381 6:147909170-147909192 CCACACGCCAGCCTAGGCTGGAG No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data
1016776385_1016776390 -4 Left 1016776385 6:147909195-147909217 CCTGCAACAACAACAAAAAAACT No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data
1016776384_1016776390 -3 Left 1016776384 6:147909194-147909216 CCCTGCAACAACAACAAAAAAAC No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data
1016776383_1016776390 10 Left 1016776383 6:147909181-147909203 CCTAGGCTGGAGACCCTGCAACA No data
Right 1016776390 6:147909214-147909236 AACTAGGCCTTGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016776390 Original CRISPR AACTAGGCCTTGATGTGGAG GGG Intergenic
No off target data available for this crispr