ID: 1016782296

View in Genome Browser
Species Human (GRCh38)
Location 6:147972765-147972787
Sequence GCTTGTGGCGAGCCACGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016782287_1016782296 27 Left 1016782287 6:147972715-147972737 CCTTCCCATGGGTGATCCCAGAG No data
Right 1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG No data
1016782289_1016782296 22 Left 1016782289 6:147972720-147972742 CCATGGGTGATCCCAGAGAGCAC No data
Right 1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG No data
1016782293_1016782296 10 Left 1016782293 6:147972732-147972754 CCAGAGAGCACACAGAATAGGGA No data
Right 1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG No data
1016782288_1016782296 23 Left 1016782288 6:147972719-147972741 CCCATGGGTGATCCCAGAGAGCA No data
Right 1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG No data
1016782291_1016782296 11 Left 1016782291 6:147972731-147972753 CCCAGAGAGCACACAGAATAGGG No data
Right 1016782296 6:147972765-147972787 GCTTGTGGCGAGCCACGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016782296 Original CRISPR GCTTGTGGCGAGCCACGTGT GGG Intergenic
No off target data available for this crispr