ID: 1016785868

View in Genome Browser
Species Human (GRCh38)
Location 6:148010506-148010528
Sequence TTTTAGCCACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016785868_1016785878 14 Left 1016785868 6:148010506-148010528 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016785878 6:148010543-148010565 ACTTGGCCTATTGCTTCAGAGGG No data
1016785868_1016785877 13 Left 1016785868 6:148010506-148010528 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016785877 6:148010542-148010564 AACTTGGCCTATTGCTTCAGAGG No data
1016785868_1016785875 -3 Left 1016785868 6:148010506-148010528 CCCAGCTCCAGCTGTGGCTAAAA No data
Right 1016785875 6:148010526-148010548 AAAGGGGCCAAGGTACAACTTGG 0: 21
1: 244
2: 532
3: 647
4: 738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016785868 Original CRISPR TTTTAGCCACAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr