ID: 1016787971

View in Genome Browser
Species Human (GRCh38)
Location 6:148034154-148034176
Sequence GTGTTGTAAGATGTTACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016787970_1016787971 5 Left 1016787970 6:148034126-148034148 CCTGGGTCGTGATACTGTGGTAC No data
Right 1016787971 6:148034154-148034176 GTGTTGTAAGATGTTACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016787971 Original CRISPR GTGTTGTAAGATGTTACCAC TGG Intergenic
No off target data available for this crispr