ID: 1016792212

View in Genome Browser
Species Human (GRCh38)
Location 6:148077882-148077904
Sequence CAGGGGAAACACCCTGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016792208_1016792212 15 Left 1016792208 6:148077844-148077866 CCTTAATGTTCTTGTCATCTCTG No data
Right 1016792212 6:148077882-148077904 CAGGGGAAACACCCTGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016792212 Original CRISPR CAGGGGAAACACCCTGAAGT AGG Intergenic
No off target data available for this crispr