ID: 1016794684

View in Genome Browser
Species Human (GRCh38)
Location 6:148105393-148105415
Sequence TGGCAGGATCGCTCAAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016794684_1016794687 -1 Left 1016794684 6:148105393-148105415 CCTGGGCTTGAGCGATCCTGCCA No data
Right 1016794687 6:148105415-148105437 ACCTTTGCCTCCCAAAGTGCTGG 0: 232
1: 31161
2: 160968
3: 284361
4: 182693
1016794684_1016794689 0 Left 1016794684 6:148105393-148105415 CCTGGGCTTGAGCGATCCTGCCA No data
Right 1016794689 6:148105416-148105438 CCTTTGCCTCCCAAAGTGCTGGG 0: 681
1: 95119
2: 308670
3: 223023
4: 122058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016794684 Original CRISPR TGGCAGGATCGCTCAAGCCC AGG (reversed) Intergenic
No off target data available for this crispr