ID: 1016796132

View in Genome Browser
Species Human (GRCh38)
Location 6:148119553-148119575
Sequence AAGAGCCCAGATTTAACACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016796132_1016796136 6 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796136 6:148119582-148119604 AAACAGGTCATTGATTTCCTGGG No data
1016796132_1016796134 -10 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG No data
1016796132_1016796142 21 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796142 6:148119597-148119619 TTCCTGGGGGTAATTCTTGGGGG No data
1016796132_1016796138 8 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796138 6:148119584-148119606 ACAGGTCATTGATTTCCTGGGGG No data
1016796132_1016796137 7 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796137 6:148119583-148119605 AACAGGTCATTGATTTCCTGGGG No data
1016796132_1016796141 20 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796141 6:148119596-148119618 TTTCCTGGGGGTAATTCTTGGGG No data
1016796132_1016796135 5 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796135 6:148119581-148119603 AAAACAGGTCATTGATTTCCTGG No data
1016796132_1016796139 18 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796139 6:148119594-148119616 GATTTCCTGGGGGTAATTCTTGG No data
1016796132_1016796140 19 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796140 6:148119595-148119617 ATTTCCTGGGGGTAATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016796132 Original CRISPR AAGAGCCCAGATTTAACACT TGG (reversed) Intergenic
No off target data available for this crispr