ID: 1016796140

View in Genome Browser
Species Human (GRCh38)
Location 6:148119595-148119617
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016796132_1016796140 19 Left 1016796132 6:148119553-148119575 CCAAGTGTTAAATCTGGGCTCTT No data
Right 1016796140 6:148119595-148119617 ATTTCCTGGGGGTAATTCTTGGG No data
1016796131_1016796140 23 Left 1016796131 6:148119549-148119571 CCATCCAAGTGTTAAATCTGGGC No data
Right 1016796140 6:148119595-148119617 ATTTCCTGGGGGTAATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016796140 Original CRISPR ATTTCCTGGGGGTAATTCTT GGG Intergenic
No off target data available for this crispr