ID: 1016796295

View in Genome Browser
Species Human (GRCh38)
Location 6:148121482-148121504
Sequence ATGTCAGTCCCACAAACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016796293_1016796295 -6 Left 1016796293 6:148121465-148121487 CCTGGGACACTGTTGCCATGTCA No data
Right 1016796295 6:148121482-148121504 ATGTCAGTCCCACAAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016796295 Original CRISPR ATGTCAGTCCCACAAACACG TGG Intergenic
No off target data available for this crispr