ID: 1016796299

View in Genome Browser
Species Human (GRCh38)
Location 6:148121514-148121536
Sequence AATTTCTGCCATGGTCAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016796293_1016796299 26 Left 1016796293 6:148121465-148121487 CCTGGGACACTGTTGCCATGTCA No data
Right 1016796299 6:148121514-148121536 AATTTCTGCCATGGTCAGTTAGG No data
1016796296_1016796299 1 Left 1016796296 6:148121490-148121512 CCCACAAACACGTGGAAGATCTA No data
Right 1016796299 6:148121514-148121536 AATTTCTGCCATGGTCAGTTAGG No data
1016796294_1016796299 11 Left 1016796294 6:148121480-148121502 CCATGTCAGTCCCACAAACACGT No data
Right 1016796299 6:148121514-148121536 AATTTCTGCCATGGTCAGTTAGG No data
1016796297_1016796299 0 Left 1016796297 6:148121491-148121513 CCACAAACACGTGGAAGATCTAA No data
Right 1016796299 6:148121514-148121536 AATTTCTGCCATGGTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016796299 Original CRISPR AATTTCTGCCATGGTCAGTT AGG Intergenic
No off target data available for this crispr