ID: 1016797424

View in Genome Browser
Species Human (GRCh38)
Location 6:148132878-148132900
Sequence TTGTATCCTCATATAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016797421_1016797424 3 Left 1016797421 6:148132852-148132874 CCTGGTTCAGAGATGGCGCCTTC No data
Right 1016797424 6:148132878-148132900 TTGTATCCTCATATAGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016797424 Original CRISPR TTGTATCCTCATATAGTGGA AGG Intergenic
No off target data available for this crispr