ID: 1016797956

View in Genome Browser
Species Human (GRCh38)
Location 6:148137970-148137992
Sequence CTGTATATGCAAATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016797956_1016797960 26 Left 1016797956 6:148137970-148137992 CCATTGTCCATTTGCATATACAG No data
Right 1016797960 6:148138019-148138041 GTGCTCATCTCCCCTTCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016797956 Original CRISPR CTGTATATGCAAATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr