ID: 1016800004

View in Genome Browser
Species Human (GRCh38)
Location 6:148158737-148158759
Sequence CTCAACATACATAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016799999_1016800004 30 Left 1016799999 6:148158684-148158706 CCCAAGATTTCTTTTGACATTCT No data
Right 1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG No data
1016800000_1016800004 29 Left 1016800000 6:148158685-148158707 CCAAGATTTCTTTTGACATTCTG No data
Right 1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG No data
1016800001_1016800004 -5 Left 1016800001 6:148158719-148158741 CCTTACATTTAATAGATACTCAA No data
Right 1016800004 6:148158737-148158759 CTCAACATACATAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016800004 Original CRISPR CTCAACATACATAGGAAGGA AGG Intergenic
No off target data available for this crispr