ID: 1016800873

View in Genome Browser
Species Human (GRCh38)
Location 6:148167815-148167837
Sequence CCTTATGTCTACAGAGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016800873_1016800880 24 Left 1016800873 6:148167815-148167837 CCAGTTTCTCTGTAGACATAAGG No data
Right 1016800880 6:148167862-148167884 CTGCATCTGCTCAGGCTGAGGGG No data
1016800873_1016800879 23 Left 1016800873 6:148167815-148167837 CCAGTTTCTCTGTAGACATAAGG No data
Right 1016800879 6:148167861-148167883 CCTGCATCTGCTCAGGCTGAGGG No data
1016800873_1016800877 22 Left 1016800873 6:148167815-148167837 CCAGTTTCTCTGTAGACATAAGG No data
Right 1016800877 6:148167860-148167882 ACCTGCATCTGCTCAGGCTGAGG No data
1016800873_1016800876 16 Left 1016800873 6:148167815-148167837 CCAGTTTCTCTGTAGACATAAGG No data
Right 1016800876 6:148167854-148167876 TCACTCACCTGCATCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016800873 Original CRISPR CCTTATGTCTACAGAGAAAC TGG (reversed) Intergenic
No off target data available for this crispr