ID: 1016803064

View in Genome Browser
Species Human (GRCh38)
Location 6:148185852-148185874
Sequence TGGTCCTCTGACTGGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016803058_1016803064 30 Left 1016803058 6:148185799-148185821 CCATGGAGAACAGCTGAGTTTAC No data
Right 1016803064 6:148185852-148185874 TGGTCCTCTGACTGGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016803064 Original CRISPR TGGTCCTCTGACTGGCTTGC TGG Intergenic
No off target data available for this crispr