ID: 1016804201

View in Genome Browser
Species Human (GRCh38)
Location 6:148196546-148196568
Sequence GCTCACTGGGAGAAAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016804201_1016804205 10 Left 1016804201 6:148196546-148196568 CCATCCTCTTTCTCCCAGTGAGC No data
Right 1016804205 6:148196579-148196601 ACCTGCCTCATTGAAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016804201 Original CRISPR GCTCACTGGGAGAAAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr