ID: 1016806608

View in Genome Browser
Species Human (GRCh38)
Location 6:148218348-148218370
Sequence TACATGTTAGGTTATGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016806608_1016806614 26 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806614 6:148218397-148218419 TTATTTTACGCTTCAGTAAGGGG No data
1016806608_1016806612 24 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806612 6:148218395-148218417 AGTTATTTTACGCTTCAGTAAGG No data
1016806608_1016806613 25 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data
1016806608_1016806610 -10 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016806608 Original CRISPR TACATGTTAGGTTATGTTTT TGG (reversed) Intergenic
No off target data available for this crispr