ID: 1016806609

View in Genome Browser
Species Human (GRCh38)
Location 6:148218360-148218382
Sequence CTCTGTCATCTTTACATGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016806609_1016806614 14 Left 1016806609 6:148218360-148218382 CCTAACATGTAAAGATGACAGAG No data
Right 1016806614 6:148218397-148218419 TTATTTTACGCTTCAGTAAGGGG No data
1016806609_1016806612 12 Left 1016806609 6:148218360-148218382 CCTAACATGTAAAGATGACAGAG No data
Right 1016806612 6:148218395-148218417 AGTTATTTTACGCTTCAGTAAGG No data
1016806609_1016806613 13 Left 1016806609 6:148218360-148218382 CCTAACATGTAAAGATGACAGAG No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016806609 Original CRISPR CTCTGTCATCTTTACATGTT AGG (reversed) Intergenic
No off target data available for this crispr