ID: 1016806610

View in Genome Browser
Species Human (GRCh38)
Location 6:148218361-148218383
Sequence CTAACATGTAAAGATGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016806608_1016806610 -10 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data
1016806606_1016806610 -5 Left 1016806606 6:148218343-148218365 CCAACCCAAAAACATAACCTAAC No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data
1016806603_1016806610 20 Left 1016806603 6:148218318-148218340 CCACAGATGGTCACACAATAAGA No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data
1016806604_1016806610 -3 Left 1016806604 6:148218341-148218363 CCCCAACCCAAAAACATAACCTA No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data
1016806605_1016806610 -4 Left 1016806605 6:148218342-148218364 CCCAACCCAAAAACATAACCTAA No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data
1016806607_1016806610 -9 Left 1016806607 6:148218347-148218369 CCCAAAAACATAACCTAACATGT No data
Right 1016806610 6:148218361-148218383 CTAACATGTAAAGATGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016806610 Original CRISPR CTAACATGTAAAGATGACAG AGG Intergenic
No off target data available for this crispr