ID: 1016806613

View in Genome Browser
Species Human (GRCh38)
Location 6:148218396-148218418
Sequence GTTATTTTACGCTTCAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016806607_1016806613 26 Left 1016806607 6:148218347-148218369 CCCAAAAACATAACCTAACATGT No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data
1016806608_1016806613 25 Left 1016806608 6:148218348-148218370 CCAAAAACATAACCTAACATGTA No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data
1016806606_1016806613 30 Left 1016806606 6:148218343-148218365 CCAACCCAAAAACATAACCTAAC No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data
1016806609_1016806613 13 Left 1016806609 6:148218360-148218382 CCTAACATGTAAAGATGACAGAG No data
Right 1016806613 6:148218396-148218418 GTTATTTTACGCTTCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016806613 Original CRISPR GTTATTTTACGCTTCAGTAA GGG Intergenic
No off target data available for this crispr