ID: 1016807950

View in Genome Browser
Species Human (GRCh38)
Location 6:148232049-148232071
Sequence GTCAAACAGAATTGGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016807950_1016807954 1 Left 1016807950 6:148232049-148232071 CCTTGAACCCAATTCTGTTTGAC No data
Right 1016807954 6:148232073-148232095 CCAAAGTCCATGCTCTTACTCGG No data
1016807950_1016807957 27 Left 1016807950 6:148232049-148232071 CCTTGAACCCAATTCTGTTTGAC No data
Right 1016807957 6:148232099-148232121 GATCTGGACAAGAGTTGTAGTGG No data
1016807950_1016807956 11 Left 1016807950 6:148232049-148232071 CCTTGAACCCAATTCTGTTTGAC No data
Right 1016807956 6:148232083-148232105 TGCTCTTACTCGGTATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016807950 Original CRISPR GTCAAACAGAATTGGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr