ID: 1016808313

View in Genome Browser
Species Human (GRCh38)
Location 6:148235208-148235230
Sequence ATGTGTATGGTGGAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016808305_1016808313 25 Left 1016808305 6:148235160-148235182 CCAAACCCAATTCTGCAAAGAAC No data
Right 1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG No data
1016808306_1016808313 20 Left 1016808306 6:148235165-148235187 CCCAATTCTGCAAAGAACGTAAG No data
Right 1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG No data
1016808307_1016808313 19 Left 1016808307 6:148235166-148235188 CCAATTCTGCAAAGAACGTAAGT No data
Right 1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016808313 Original CRISPR ATGTGTATGGTGGAGGTGGA TGG Intergenic
No off target data available for this crispr