ID: 1016811258

View in Genome Browser
Species Human (GRCh38)
Location 6:148263217-148263239
Sequence CCGAAGAAGCAGAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016811250_1016811258 30 Left 1016811250 6:148263164-148263186 CCAAGAAAAACCTGATGAGTCAG No data
Right 1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG No data
1016811251_1016811258 20 Left 1016811251 6:148263174-148263196 CCTGATGAGTCAGTGAATGAATA No data
Right 1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016811258 Original CRISPR CCGAAGAAGCAGAAGGTGGC AGG Intergenic
No off target data available for this crispr