ID: 1016813946

View in Genome Browser
Species Human (GRCh38)
Location 6:148286664-148286686
Sequence GTGTCCTTCTAGAAGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 15, 3: 26, 4: 273}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016813946 Original CRISPR GTGTCCTTCTAGAAGAGGAG GGG (reversed) Intronic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
901920043 1:12529461-12529483 GCGTCTATCTGGAAGAGGAGAGG + Intergenic
902457929 1:16549168-16549190 GTGTGTTTTTAGTAGAGGAGGGG - Intergenic
902475376 1:16681508-16681530 GTGTGTTTTTAGTAGAGGAGGGG - Intergenic
902494230 1:16858746-16858768 GTGTGTTTTTAGTAGAGGAGGGG + Intronic
902678489 1:18026447-18026469 GTGTTATGCTAGAAGAGGAATGG - Intergenic
905118768 1:35665543-35665565 TTGTATTTCTAGTAGAGGAGGGG + Intergenic
905712359 1:40117011-40117033 GCATACTTCTAGAAGAGGAGAGG - Intergenic
905981636 1:42234449-42234471 GTGTTCCTCTGGAGGAGGAGAGG + Intronic
906589179 1:47007519-47007541 GTGTTCCTTTGGAAGAGGAGAGG - Intergenic
906679783 1:47718353-47718375 GGGTCCATGTAGATGAGGAGTGG - Intergenic
907094852 1:51768384-51768406 TTGTACTTTTAGTAGAGGAGGGG + Intronic
908014442 1:59815812-59815834 CTGTCCATTTAGAGGAGGAGAGG - Intronic
911215427 1:95187875-95187897 GCCTCCTGCAAGAAGAGGAGAGG - Intronic
911495316 1:98624280-98624302 GTGTTCCTCTGGAAGAGAAGAGG + Intergenic
911668450 1:100582084-100582106 GAGTCCATCAAGATGAGGAGAGG - Intergenic
912307565 1:108585411-108585433 GTTTCCTTCTATGTGAGGAGTGG + Intronic
913322281 1:117597334-117597356 GTGGGCTTCTGGAAGATGAGAGG + Intergenic
913983071 1:143541442-143541464 GTGTGTTTTTAGTAGAGGAGGGG + Intergenic
915548147 1:156615206-156615228 GAGACCTTCTAGTAGAGGACAGG - Intergenic
916262699 1:162858331-162858353 GTGTCCTTTTTGAATAAGAGTGG + Intronic
918062693 1:181075585-181075607 GTGTGCTTCCAGAAGAGATGAGG + Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919458246 1:197845791-197845813 GTGTCATTCTAGAACAGTAAGGG - Intergenic
921329255 1:214019360-214019382 GTGCCCTTCTAGCAGAAGACAGG + Intronic
921844564 1:219864527-219864549 GTGTTCATTTAGAGGAGGAGAGG - Intronic
923209321 1:231788853-231788875 GTGTGCCTCTAGCAGAGGTGAGG + Intronic
924334986 1:242978550-242978572 GTGTCCTGACGGAAGAGGAGTGG - Intergenic
924588086 1:245377405-245377427 TTGTCCTTATAGAAAAGAAGAGG - Intronic
924679064 1:246212927-246212949 GTGTCCTTCCAGAAGATATGGGG + Intronic
1064992103 10:21265211-21265233 GTGTTCTTATAAAAGAGGTGCGG - Intergenic
1065524976 10:26610967-26610989 GTGTCCTTATAAAAGAGGCCGGG + Intergenic
1066232572 10:33451198-33451220 GTGTCCTTATAAAAGAGGCCCGG - Intergenic
1066416470 10:35226295-35226317 GGGTCCTTCTAGGAGGGAAGTGG + Intergenic
1066813501 10:39372164-39372186 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
1067919473 10:50438702-50438724 ATGTCCTTCTGAGAGAGGAGAGG + Intronic
1068050721 10:51946509-51946531 GTGTTCCTTTGGAAGAGGAGAGG + Intronic
1068582392 10:58756489-58756511 GTGTCCTGCTAGAAAGGGAATGG - Intronic
1069222274 10:65899552-65899574 TTGTCTTTCTTGAAGAGCAGAGG + Intergenic
1069345014 10:67458576-67458598 GTCCTCTTCTAGAAGAGGACAGG + Intronic
1069660029 10:70117381-70117403 GTGGCCTTCTTGTAGAGCAGGGG - Intronic
1070514478 10:77190896-77190918 TTGTTCTCCTAGAATAGGAGAGG - Intronic
1072134388 10:92530051-92530073 GTGTACTTTTAGTAGAGGCGGGG - Intronic
1072908216 10:99474970-99474992 GAGTCCTCCAAGAAAAGGAGAGG + Intergenic
1074070549 10:110064250-110064272 GTGTATTTCTGGGAGAGGAGTGG + Intronic
1074303293 10:112251990-112252012 GTGTTCCTTTAGAGGAGGAGAGG - Intergenic
1076238253 10:128882722-128882744 GGGTCCTTCTTGGAGATGAGAGG - Intergenic
1076762970 10:132614832-132614854 GTGTCCTTGTAGGATAGAAGGGG - Intronic
1077590922 11:3490448-3490470 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080991320 11:37539392-37539414 GTTTCCTTGTACAAGAAGAGTGG + Intergenic
1081231455 11:40590527-40590549 GTGTTCCTTTGGAAGAGGAGAGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082902926 11:58275780-58275802 CTGTCCTTCTATAAGAGCAGGGG + Intergenic
1084246641 11:67862198-67862220 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
1084826038 11:71732293-71732315 GTGTCCTTATAAAAGAGGAGAGG - Intergenic
1086601176 11:88636048-88636070 TTGTCTTTCTAGAAAAGCAGTGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1089540950 11:119188652-119188674 GTGTTCTCCAAGAAGAGGAGTGG - Exonic
1090185695 11:124737978-124738000 GTGTCCTTCAGGAAGAGGGAAGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1090975237 11:131674321-131674343 CTGTCATTCTTGAAAAGGAGAGG + Intronic
1091003545 11:131931712-131931734 GTGGCCTTCTAGACCAGCAGTGG - Intronic
1092036487 12:5339791-5339813 GTGTCCTTCAAGGATAGGATGGG - Intergenic
1092417208 12:8299445-8299467 GTGTCCTTATAAAAAAGGAGAGG + Intergenic
1094369388 12:29720158-29720180 GTGTCGTGCTAGGAAAGGAGTGG + Intronic
1094634751 12:32215054-32215076 TTGTCCTTTTAGTAGAGAAGGGG - Intronic
1094861962 12:34477383-34477405 GTGTTCTTTTGGAGGAGGAGAGG - Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098502563 12:71210505-71210527 GTGTCCTTCTAGAAGAATAAAGG - Intronic
1099474683 12:83094060-83094082 GTGTCCTGATAGAAGAGCTGTGG + Intronic
1099696429 12:86027162-86027184 GTGTCATAATAGAAGAGGAAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101401656 12:104393609-104393631 GTGTTCCTTTGGAAGAGGAGAGG + Intergenic
1102813471 12:115843699-115843721 GTGTTCTTTTAGAAGAGGAGAGG + Intergenic
1104968230 12:132519242-132519264 GTGTCTCTCTAAAAGAGAAGTGG - Intronic
1106485148 13:30165969-30165991 GTGTCCCTCTGGGAGAGCAGAGG + Intergenic
1107818013 13:44261658-44261680 ATGTCCATCAAGAAGAGGAAGGG + Intergenic
1109212878 13:59555125-59555147 GTGTCCATCAAGAAAACGAGTGG + Intergenic
1109551365 13:63905302-63905324 GTATCTTACTAGAAGAAGAGAGG + Intergenic
1111723234 13:91973516-91973538 GTGTTCTTTTGGAGGAGGAGAGG + Intronic
1112552271 13:100432659-100432681 GTGTCCTCATAATAGAGGAGGGG + Intronic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116036924 14:39638571-39638593 GTGTTCCTTTGGAAGAGGAGAGG + Intergenic
1116292689 14:43063290-43063312 GTGTTCTTTTGGAGGAGGAGAGG - Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117965888 14:61206399-61206421 GTTTCCTATAAGAAGAGGAGAGG - Intronic
1119419803 14:74501779-74501801 GTGTCATTTTAGATGGGGAGAGG + Intronic
1120397023 14:83980905-83980927 TTGTATTTTTAGAAGAGGAGAGG - Intergenic
1121790742 14:96697790-96697812 GTGTCCCTGTGGAAAAGGAGAGG + Intergenic
1122343709 14:101045247-101045269 CTCTCCTTCAAGAAGGGGAGAGG - Intergenic
1122376892 14:101267152-101267174 GTGTTCCTTTGGAAGAGGAGAGG - Intergenic
1123826482 15:24087143-24087165 GTGTCCTACTTCAAGAGGACTGG + Intergenic
1124834038 15:33178185-33178207 ATGTTCTTCTAGAATAGAAGTGG - Intronic
1127210979 15:56774335-56774357 TTTTCCTATTAGAAGAGGAGAGG - Intronic
1131812352 15:96185675-96185697 GAGGCCTTCTGGAAGAGGGGAGG - Intergenic
1131998879 15:98160254-98160276 GTTTCCTTTTGGAAGAGGATGGG - Intergenic
1133356298 16:5139481-5139503 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
1133701645 16:8314838-8314860 GTGTCCTTACAGAAGAGGTGAGG - Intergenic
1133712883 16:8418474-8418496 GTGTATTTATAGAAGAGGTGAGG - Intergenic
1133862887 16:9612976-9612998 CTGTCCTTATAGCAGAGAAGAGG - Intergenic
1135252540 16:20913184-20913206 GATTCCTTCTAGGAGAGGAAGGG + Intronic
1137379772 16:47986575-47986597 CTGCCCTTCTGGAAGTGGAGTGG + Intergenic
1137755400 16:50898184-50898206 TGGTCCTTCTAGAATAGAAGGGG - Intergenic
1138427200 16:56943250-56943272 GGGGCCTTCTGGAAGAAGAGAGG - Exonic
1138436315 16:57002318-57002340 TTGTACTTTTAGTAGAGGAGGGG + Intronic
1138963760 16:62058634-62058656 GTTTCCTGCAAGATGAGGAGAGG - Intergenic
1141144801 16:81521514-81521536 TTCTGCTTCCAGAAGAGGAGGGG + Intronic
1141569133 16:84923622-84923644 GTGTCCTTCTAGGAAACAAGGGG - Intergenic
1141907031 16:87033625-87033647 GCCTCCTTCCAGCAGAGGAGGGG - Intergenic
1142222787 16:88863822-88863844 GTGGCCTTCCAGAGGAGAAGGGG + Intronic
1142493326 17:292721-292743 CTGTCGTTCTGGAAGAGGAGAGG - Intronic
1144539299 17:16123617-16123639 GTGTGCATCAAGAAGAGAAGTGG - Intronic
1145400825 17:22530933-22530955 GTGTCCTCCTAGTTGAGGGGTGG - Intergenic
1145804681 17:27718008-27718030 GTTTCCTTCTGAAATAGGAGAGG - Intergenic
1146783247 17:35695175-35695197 GTAGGCTGCTAGAAGAGGAGAGG + Intronic
1146823097 17:36000287-36000309 GTGTCTTTTTAGTAGAGGCGGGG - Intronic
1154403560 18:14066063-14066085 GTGTTCTTTTGGAGGAGGAGAGG - Intronic
1155331962 18:24727825-24727847 GGCTCCTCTTAGAAGAGGAGAGG + Intergenic
1157161855 18:45320838-45320860 TTTTCCTTCTGGAAAAGGAGTGG - Intronic
1158482654 18:57835649-57835671 GGGTCACTCTAGAAGAGGAATGG + Intergenic
1159327727 18:66945751-66945773 GTGACTTTCTATAAGGGGAGTGG + Intergenic
1161696385 19:5771026-5771048 GTGTCATAGTAGACGAGGAGAGG - Exonic
1163640651 19:18460240-18460262 GTTGGCTTGTAGAAGAGGAGGGG - Intronic
1164797656 19:31047151-31047173 ATGTCCTTGTAGACCAGGAGGGG - Intergenic
1164809764 19:31146949-31146971 GTGCACTTGTAGAAGAGGAGAGG + Intergenic
1165043726 19:33087560-33087582 GTGACGTTCTAGAAGAGGTATGG + Intronic
1165824247 19:38696694-38696716 TTGTCCTCCTGGAAGATGAGGGG - Intronic
1166175999 19:41070428-41070450 TTGTACTTTTAGTAGAGGAGGGG - Intergenic
1166502998 19:43354621-43354643 GTTTGCTCTTAGAAGAGGAGGGG - Intronic
1166507455 19:43380111-43380133 GTTTGCTCTTAGAAGAGGAGGGG + Intergenic
1202709616 1_KI270714v1_random:10562-10584 GTGTGTTTTTAGTAGAGGAGGGG - Intergenic
926185494 2:10687453-10687475 TTGTCATCCAAGAAGAGGAGGGG - Intronic
926578878 2:14613113-14613135 GTGTCCTGAAAGAAGAGAAGGGG + Intergenic
928251970 2:29689046-29689068 GTGTCCTCATAGATGAGGACAGG - Intronic
929291713 2:40199681-40199703 GTGTTTTTCTAAATGAGGAGAGG - Intronic
929715080 2:44301885-44301907 TTGTAGTTCTAGTAGAGGAGGGG - Intronic
930106221 2:47642043-47642065 GTGTCTTGATAGAACAGGAGGGG - Intergenic
931476037 2:62588551-62588573 GCATACTTCTAGAAGAGGGGTGG - Intergenic
933077739 2:77950907-77950929 GTGCCCTTCTAGAAGAGTGAAGG + Intergenic
933982126 2:87559240-87559262 GTTCCATTCTAGGAGAGGAGGGG - Intergenic
934692657 2:96373570-96373592 GTGACCATCTAGGAGAGGGGAGG + Exonic
934747739 2:96770605-96770627 AAGTCCGTCTAGAAAAGGAGGGG - Intronic
934831171 2:97526496-97526518 GTGTTCCTTTGGAAGAGGAGAGG - Intronic
935369080 2:102325444-102325466 GTGTTCCTCTGGAGGAGGAGGGG - Intronic
935828187 2:106972416-106972438 GTGTCCTTTTCGAAAAGGACTGG + Intergenic
936311711 2:111391570-111391592 GTTCCATTCTAGGAGAGGAGGGG + Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
941895729 2:170627600-170627622 GTGTTCCTTTGGAAGAGGAGAGG + Intronic
942682015 2:178486873-178486895 GTGTATCTCTAGAAGTGGAGTGG + Intronic
944035485 2:195290268-195290290 GAGTCCTTGGGGAAGAGGAGCGG + Intergenic
944763878 2:202844659-202844681 ATTTCTTTCTAGAGGAGGAGTGG - Intronic
945072676 2:206006872-206006894 TTGTACTTCTAGTAGAGGTGGGG - Intronic
945994424 2:216424063-216424085 GTGTACTTCTAGAACTGGATGGG + Intronic
947059670 2:226149250-226149272 GTGTTCTTCTAAAAGAGAAAAGG - Intergenic
947736200 2:232456716-232456738 GAGTCCTCCAAGCAGAGGAGAGG + Intronic
947928117 2:233938884-233938906 GCCTGCTTCTAGAAGAGGGGCGG - Intronic
948710056 2:239819820-239819842 GTGTCTCTCAAGATGAGGAGTGG + Intergenic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
949031454 2:241799255-241799277 GTCTCCCTCTGGAAGAGGAGGGG + Intronic
1170386529 20:15824433-15824455 GTTACTTTCTAGAATAGGAGGGG + Intronic
1171776872 20:29376793-29376815 GTGTCCTTATCCAAGAAGAGGGG - Intergenic
1173529512 20:43758244-43758266 GTGTCCATCAAGATGTGGAGTGG + Intergenic
1174606264 20:51763986-51764008 GTGTGCTTCTTTGAGAGGAGGGG - Intronic
1176298123 21:5085205-5085227 GTGTCCTTCGAGAAGAGAAGGGG + Intergenic
1177715824 21:24839091-24839113 GTGTGTTTTTAGTAGAGGAGGGG - Intergenic
1179226056 21:39454535-39454557 GTGGCCTTCTGGAAGAGAGGAGG - Intronic
1179542947 21:42095494-42095516 GTGTCCTTATAAAAGAGAATCGG - Intronic
1179858906 21:44176744-44176766 GTGTCCTTCGAGAAGAGAAGGGG - Intergenic
1180783132 22:18532623-18532645 TTGTACTTTTAGAAGAGAAGGGG - Intergenic
1181126694 22:20706669-20706691 TTGTACTTTTAGAAGAGAAGGGG - Intergenic
1181240030 22:21471980-21472002 TTGTACTTTTAGAAGAGAAGGGG - Intergenic
1181861839 22:25824764-25824786 GTGTGCATGTCGAAGAGGAGAGG - Intronic
1181912056 22:26246260-26246282 GTGTCTTTCTACAACAGGAGAGG - Intronic
1182756494 22:32683854-32683876 GTGTACTTCTAGACTATGAGGGG - Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184536700 22:45092487-45092509 GGGTCTTTCTAGAAGCAGAGGGG + Intergenic
1184536710 22:45092550-45092572 GGGTCTTTCTAGAAGCAGAGGGG + Intergenic
1184740122 22:46423164-46423186 GTGGCCTGCTGGAAGATGAGAGG + Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
955048941 3:55389800-55389822 GTGTTCCTCTGGAGGAGGAGAGG - Intergenic
957060954 3:75480949-75480971 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
959019517 3:101173217-101173239 GTGCCCTTATAAAAGAGGTGAGG - Intergenic
959656014 3:108805841-108805863 GTGTACTTTTAGTAGAGGTGAGG - Intergenic
960576775 3:119238092-119238114 TTGTACTTTTAGTAGAGGAGGGG - Intronic
960705655 3:120478244-120478266 GTGTCCCTCTAAGAGAGAAGGGG - Intergenic
961276066 3:125727820-125727842 TTGTGTTTCTAGAAGAGAAGGGG + Intergenic
961292428 3:125858471-125858493 GTGTCCTTATAAAAGAGGAGAGG - Intergenic
961894756 3:130157936-130157958 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964228828 3:154438622-154438644 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
964550340 3:157878162-157878184 GTGCCCAGCTAGGAGAGGAGGGG + Intergenic
964674192 3:159259075-159259097 ATGTTTATCTAGAAGAGGAGAGG - Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966895765 3:184443859-184443881 TTGTCCTCCCAGAAGAGCAGGGG - Intronic
969004858 4:4010989-4011011 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
969210671 4:5684832-5684854 GTGTCCTTATAGAAGAGGCTAGG + Intronic
969603996 4:8193168-8193190 AGGTCGTTCTAGAAGAGGGGAGG - Intronic
969748019 4:9089159-9089181 GTGTCCTTATAAAAGAGGAGAGG - Intergenic
969809046 4:9633697-9633719 GTGTCCTTATAAAACAGGAGAGG - Intergenic
970155437 4:13136940-13136962 GTTTCCTTCTAGAAAACTAGGGG + Intergenic
976271222 4:83232104-83232126 GTGTCCTGGTAGTAGAGCAGGGG + Intergenic
976976587 4:91172720-91172742 TTTTCCTCCTAGAAGAGTAGTGG + Intronic
977093050 4:92703482-92703504 GTGACCTCCTAGAAGAGAATGGG + Intronic
979242130 4:118456729-118456751 GTGTCCTGATGGAAGAGGAGTGG + Intergenic
980501200 4:133656277-133656299 GTGTTCTTATAAAAGAGAAGAGG - Intergenic
981713815 4:147733261-147733283 GAGTCTTTCTAGGAGAGAAGGGG + Intronic
985247034 4:187989305-187989327 GTGTCCTTATAAAGGAGGCGTGG - Intergenic
988266108 5:28953098-28953120 GTGTTCCTTTGGAAGAGGAGAGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989860730 5:46372324-46372346 GTGTTCCTTTAGAGGAGGAGAGG - Intergenic
990199450 5:53354737-53354759 GTGTTCTTCGGGAAGAGAAGAGG - Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
992397387 5:76380463-76380485 GTGGTCTTCATGAAGAGGAGAGG + Intergenic
994301350 5:98151891-98151913 GGCTCCTTCTGGAAGAGAAGAGG + Intergenic
994572309 5:101529967-101529989 GTGTTCCTTTGGAAGAGGAGAGG - Intergenic
996447866 5:123577883-123577905 GATTGCTTCTAGAAAAGGAGGGG - Intronic
996455758 5:123679607-123679629 GTGTCCCTTTGGAGGAGGAGAGG + Intergenic
996487935 5:124058536-124058558 GTATCCTTATAAAAGAGGAAAGG - Intergenic
997367324 5:133334414-133334436 GTGGCCTTTTGAAAGAGGAGAGG - Intronic
998389364 5:141777597-141777619 CAGTCCTACTAGAAGAGGAATGG + Intergenic
998852331 5:146363162-146363184 ATGTTCTTCTACAAGAGGAGTGG + Intergenic
999380894 5:151120542-151120564 TTGTCTTTCTAGTAGAGAAGGGG - Intronic
999548578 5:152659008-152659030 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1000561763 5:162798302-162798324 GTGTCCTTCAAGAAGACTTGTGG + Intergenic
1003146258 6:3512959-3512981 GTGTCCTTGAAGGAGGGGAGAGG + Intergenic
1005815488 6:29548686-29548708 GTTTCCTTATAAAAGAGGAAAGG - Intergenic
1006526112 6:34606528-34606550 GTGCCCTTGGAGAAGAGAAGGGG - Intronic
1008140173 6:47822933-47822955 GTGTCCTTTGAAAACAGGAGAGG - Intronic
1008202386 6:48607028-48607050 TTGTCTTTCAAGAAGAGCAGAGG - Intergenic
1008214893 6:48777275-48777297 GTGTCCTTGTTGGAGAAGAGGGG - Intergenic
1008349990 6:50478602-50478624 GTGTTCCTCTGGAGGAGGAGAGG - Intergenic
1009543060 6:64989239-64989261 GTCTGCTTATAGAAGAGAAGAGG - Intronic
1011395211 6:86898661-86898683 GCGTTCTTTTAGAGGAGGAGAGG - Intergenic
1012620760 6:101340729-101340751 GTGTCCTTGCAGAGGGGGAGTGG + Intergenic
1012772207 6:103452658-103452680 ATGACCTGCTAGAAGTGGAGAGG - Intergenic
1013344806 6:109250274-109250296 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1016813946 6:148286664-148286686 GTGTCCTTCTAGAAGAGGAGGGG - Intronic
1019035093 6:169047864-169047886 TTGTACTTTTAGTAGAGGAGAGG - Intergenic
1019178804 6:170174931-170174953 GTGTCCTTATAAAAGGGGCGTGG - Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1019463514 7:1173880-1173902 GTGTCCTTAGAGAAGAGACGGGG - Intergenic
1020324989 7:6967474-6967496 GTGTCCTTATAAAAGAGGAGAGG + Intergenic
1021048073 7:15947851-15947873 GTGTTTTTCTACAAGAAGAGAGG + Intergenic
1022416836 7:30185766-30185788 GTGACCTTATAAAAGAGGTGTGG - Intergenic
1022858514 7:34340951-34340973 GTGTCTTTCAAGGAGAGCAGGGG - Intergenic
1023306976 7:38840920-38840942 GTGTACTTCAAGTACAGGAGTGG - Intronic
1023322381 7:39012573-39012595 GTGTTCCTTTAGAGGAGGAGAGG + Intronic
1024594442 7:50920239-50920261 GTGTCTTTCTAGAACATGAGTGG - Intergenic
1025712950 7:63928254-63928276 GGGTCCTTCCAGAGCAGGAGTGG + Intergenic
1027330653 7:77089589-77089611 GCGTTCCTCTAGAGGAGGAGAGG + Intergenic
1028632944 7:92955729-92955751 GTGTACTTCTAGTAGAGACGGGG - Intergenic
1029315397 7:99708057-99708079 GTGTACTGCTAGTAGAGGGGTGG - Intronic
1029785110 7:102781750-102781772 GCGTTCCTCTAGAGGAGGAGAGG - Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030971691 7:116065092-116065114 GTCTCCTTTTCGAAGAGTAGTGG - Intronic
1033707461 7:143902912-143902934 ATGTGCTTCTATAAGAGGCGGGG + Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034688636 7:152996231-152996253 ATATTCCTCTAGAAGAGGAGAGG - Intergenic
1036371076 8:8163355-8163377 GTGTCCTTATAAAAGACGAGAGG - Intergenic
1036879821 8:12502281-12502303 GTGTCCTTATAAAAGACGAGAGG + Intergenic
1037522598 8:19694631-19694653 GAGGCCTTCTAGAATAGGAAAGG + Intronic
1038704374 8:29880212-29880234 GTGTCCTTCTTCTACAGGAGTGG - Intergenic
1038925802 8:32138053-32138075 GTGTCCTTGTTGGAGAAGAGAGG + Intronic
1039438041 8:37574340-37574362 GTGTCCTTCTCTAAGGGGAGAGG - Intergenic
1039490687 8:37945192-37945214 GTGTCCTTATAAAAGAGGTTGGG - Intergenic
1040084451 8:43325481-43325503 GTGTTCCTTTAGAGGAGGAGAGG + Intergenic
1040086571 8:43349487-43349509 GTGTTCCTCTGGAAGAGGAGAGG + Intergenic
1040383146 8:46892645-46892667 GTGTCCATGCAGAAGAGGAGAGG + Intergenic
1040785766 8:51160374-51160396 GCCTCCTTCTAGTAGAGGAAGGG + Intergenic
1040989948 8:53338739-53338761 GTGTTCTTTTGGAGGAGGAGAGG - Intergenic
1042076481 8:65000898-65000920 GTGTCATTCCTGGAGAGGAGAGG + Intergenic
1042517255 8:69672656-69672678 GTCTCCTTCTTGGAGAGAAGCGG + Exonic
1042828213 8:72999342-72999364 GTGTCCTTATAAAAGAGGTTGGG + Intergenic
1044714462 8:95087975-95087997 GTTTCCTGGTAGCAGAGGAGAGG + Intronic
1045677591 8:104625325-104625347 GTGTTCTTGTAGAAGAGGAGTGG + Intronic
1045797817 8:106066158-106066180 GTGATCTTCTTGAGGAGGAGAGG - Intergenic
1046640802 8:116728699-116728721 GTGCCTTTCAAGAAGTGGAGAGG - Intronic
1046743340 8:117851397-117851419 GTTTCATTCTGTAAGAGGAGTGG + Intronic
1048049041 8:130799850-130799872 GTGTCCTTCAAGATGGGGAATGG + Intronic
1048104035 8:131387921-131387943 GTTTGCCTCCAGAAGAGGAGGGG - Intergenic
1050048452 9:1574070-1574092 GTGTTCCTTTAGAGGAGGAGAGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1053416211 9:37948422-37948444 CTGCCCTTCCAGAAGATGAGGGG - Intronic
1053438784 9:38096270-38096292 CTGTCCTTCTCAAAGATGAGTGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056051485 9:82774396-82774418 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1056796783 9:89664010-89664032 GTGGGGGTCTAGAAGAGGAGAGG + Intergenic
1057033051 9:91793020-91793042 GTCTCTTCCTAGAAGAAGAGGGG + Intronic
1057476926 9:95411137-95411159 TTATGCTTCTAGAAGATGAGAGG + Intergenic
1058167451 9:101636053-101636075 GTGTGTTTTTAGAAGAGAAGAGG + Intronic
1058972991 9:110100306-110100328 GCTTCCTTCTAGAAGTGCAGGGG - Intronic
1060868245 9:127016869-127016891 GTGTACTTCTTGAAAAGGTGGGG - Intronic
1062280761 9:135750668-135750690 CTGTCCTCCAAGAAGTGGAGTGG + Intronic
1185914555 X:4021757-4021779 GTGTCCTTCTAAAAGAAAAGAGG + Intergenic
1187416398 X:19097003-19097025 GTGCTTTTCTAGAAGAGAAGAGG + Intronic
1190085422 X:47391549-47391571 GTCTTTTTCCAGAAGAGGAGAGG - Intronic
1190085541 X:47392381-47392403 GTCTTTTTCCAGAAGAGGAGAGG - Intronic
1190271636 X:48868755-48868777 GTGTTCCTCTGGAGGAGGAGAGG + Intergenic
1190903210 X:54698571-54698593 GTGTTCCTTTAGAGGAGGAGAGG - Intergenic
1191092421 X:56637094-56637116 GTGTTCCTTTGGAAGAGGAGAGG - Intergenic
1192362952 X:70450624-70450646 TTGTTCACCTAGAAGAGGAGAGG - Exonic
1193860052 X:86653837-86653859 GTGTACTTTTAGTAGAGAAGGGG + Intronic
1194271749 X:91824724-91824746 GTGTTCTTTTGGAGGAGGAGAGG + Intronic
1196164192 X:112520496-112520518 ATGACCTTGTAGAAGAAGAGAGG - Intergenic
1196544467 X:116946329-116946351 GTGTTCTTTTCGAGGAGGAGAGG + Intergenic
1197418842 X:126211167-126211189 GGATCCTTCCAGAAGAGAAGAGG + Intergenic
1199204860 X:145136955-145136977 CTGTCCTTCCAGAAGGGGATGGG - Intergenic
1200180057 X:154144546-154144568 GTGTCCTTCTAGATTTGGAGAGG - Intronic
1200185885 X:154182940-154182962 GTGTCCTTCTAGATTTGGAGAGG - Intergenic
1200191537 X:154220078-154220100 GTGTCCTTCTAGATTTGGAGAGG - Intronic
1200197292 X:154257882-154257904 GTGTCCTTCTAGATTTGGAGAGG - Intronic
1200588996 Y:5046161-5046183 GTGTTCTTTTGGAGGAGGAGAGG + Intronic
1201888682 Y:18917409-18917431 ATGTCCTTATCCAAGAGGAGGGG - Intergenic