ID: 1016814285

View in Genome Browser
Species Human (GRCh38)
Location 6:148289349-148289371
Sequence GCTCACGCCTTTCCACAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 115}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016814285 Original CRISPR GCTCACGCCTTTCCACAGGA AGG (reversed) Intronic
900079204 1:842951-842973 GCACACGCCCTCCCACAGGATGG + Intergenic
902324948 1:15693800-15693822 GCTCTTGCCTTTCCACATTAAGG - Intronic
905863099 1:41363151-41363173 GCTCCCCCCTTTCCACTGGCTGG - Intronic
905925369 1:41745791-41745813 GCTCTCCTCTTTCCACCGGAGGG + Intronic
906042447 1:42798546-42798568 TCTCACTCCTTTCCAAGGGATGG - Intergenic
906213394 1:44024686-44024708 GCTTCAGCCTTTCCCCAGGAGGG + Intronic
910455839 1:87396393-87396415 GCTCCTGCCTTTCCAGAGAATGG + Intergenic
915651231 1:157312364-157312386 GTTTATGCCTTTGCACAGGATGG - Intergenic
919264041 1:195238054-195238076 GGTAACTCCTTTCCACAGGCAGG - Intergenic
921674652 1:217964811-217964833 GGTAACTCCTTTCCACAGGCAGG + Intergenic
921675258 1:217968950-217968972 GGTAACTCCTTTCCACAGGCAGG - Intergenic
921675279 1:217969087-217969109 GGTAGCTCCTTTCCACAGGAAGG - Intergenic
924657292 1:245984440-245984462 GCACATGCCCTTGCACAGGAGGG - Intronic
1069702282 10:70435523-70435545 GCTCTCGGCTTCCCACAGCAAGG + Exonic
1070367884 10:75753629-75753651 GCTCAACCCTCTCCACAGGCTGG - Intronic
1074185874 10:111099013-111099035 GCCAAGGCCTTTCCCCAGGATGG + Intergenic
1076853097 10:133102731-133102753 GGTCACTCCTATCCACAGCATGG - Exonic
1077235504 11:1480224-1480246 CCTGTGGCCTTTCCACAGGAAGG + Intronic
1078880331 11:15441961-15441983 CCTAACACCTTTCCACTGGAGGG + Intergenic
1079657545 11:23001638-23001660 ACTCACCCCTTTCCACAAGAAGG + Intergenic
1083476262 11:62917536-62917558 GTTCACCCCATTCCACAGAAGGG - Intronic
1084498449 11:69519690-69519712 CCTCACACCTTTCCACTGAAGGG - Intergenic
1085671198 11:78465902-78465924 ACTCAAGCCTTTCTACATGAGGG - Exonic
1085792935 11:79511535-79511557 TCTCACTCATTTGCACAGGATGG - Intergenic
1088401105 11:109423167-109423189 GCTCATGCCACTCGACAGGATGG - Intronic
1089635270 11:119807857-119807879 GCTCACCCCCTTCCACAGGTGGG - Intergenic
1090333890 11:125950378-125950400 GCACACGCCTCTCCACGGGACGG - Intergenic
1091389498 12:117494-117516 GCTCAGCCCATCCCACAGGAAGG - Intronic
1091763800 12:3105166-3105188 GCTCAGGCCTCTACACAGCAGGG - Intronic
1094411098 12:30169740-30169762 GCCCACGCCTCTCCCCAGTATGG - Intergenic
1095603210 12:44037744-44037766 GGTCACTCCTCTCCACAGGCAGG - Intronic
1095890971 12:47235019-47235041 GCTCCTTCCTTTGCACAGGATGG - Exonic
1096060441 12:48694111-48694133 GATCATTCCTTACCACAGGATGG - Exonic
1096077367 12:48814142-48814164 GCTCTCCCCTTTCCAGTGGAGGG - Intronic
1101241226 12:102841842-102841864 GCTACCTCCTTTCCAGAGGAGGG - Intronic
1102634545 12:114311664-114311686 GCTCGCTCCTTTCCAGTGGATGG - Intergenic
1105787026 13:23759718-23759740 GCCCACCCCTTTCCACAGAATGG - Intronic
1108393492 13:49971173-49971195 GCTCACGCCTTTACTCTGGGAGG - Intergenic
1111595428 13:90404453-90404475 GGTGGCTCCTTTCCACAGGAAGG - Intergenic
1113463061 13:110495376-110495398 GGTCACCTCTTTCCCCAGGAGGG - Exonic
1117375023 14:55111974-55111996 GCACAGCCCATTCCACAGGATGG - Intergenic
1117593010 14:57295063-57295085 ACTCACGTATTTCCACAGGATGG - Exonic
1120627399 14:86845452-86845474 ACTTAGTCCTTTCCACAGGAGGG + Intergenic
1121495741 14:94390415-94390437 GCTCACTCAGTTCCACAGGTGGG - Exonic
1125735261 15:41920379-41920401 TCTCAGGCCTTTCCCCAGGGAGG + Intronic
1127477700 15:59350243-59350265 GCTCCTGCCTTTCCTCAGGGTGG + Intronic
1129750079 15:78056580-78056602 ACACAAGCATTTCCACAGGAAGG + Intronic
1130537429 15:84797427-84797449 GCCCATGCCTTCCCACAGGCTGG - Intronic
1132283700 15:100643351-100643373 TCTCATGCCTTTCCACAGTGAGG - Intronic
1138458908 16:57136489-57136511 TCTCAGGCCTTTCCAGAGAAGGG - Intronic
1140028261 16:71311731-71311753 GCTGTCTGCTTTCCACAGGAGGG - Intergenic
1140977601 16:80075054-80075076 GCTCACTACTTATCACAGGAAGG + Intergenic
1146970288 17:37066521-37066543 GCTGACGGCGGTCCACAGGAGGG + Intergenic
1148670354 17:49405401-49405423 GCTCACTCCTTGTCACGGGAGGG + Intronic
1151406463 17:73890282-73890304 GCTCAGGCCCTTGCACAGGAGGG - Intergenic
1152184061 17:78843144-78843166 GCCCAGGCCTTTTCACATGAGGG + Intergenic
1156350318 18:36297313-36297335 GCTTAAGCCTTTCCAGATGAAGG - Intergenic
1157113418 18:44842243-44842265 TCTCTAGCCTTTCCCCAGGAGGG + Intronic
1161043787 19:2123762-2123784 GGCCACACCTTTCCACAGGCGGG - Intronic
1162557602 19:11397238-11397260 GCTCACCCCGGTCCCCAGGAAGG + Exonic
1165850980 19:38850112-38850134 GCCCACGCCGTTCTGCAGGAGGG + Exonic
1168686618 19:58352965-58352987 GCTCGGGCTTGTCCACAGGATGG - Exonic
936152906 2:110031335-110031357 ACACCCACCTTTCCACAGGATGG - Intergenic
936191774 2:110340077-110340099 ACACCCACCTTTCCACAGGATGG + Intergenic
936748697 2:115613932-115613954 TCCCATGCCTCTCCACAGGAGGG + Intronic
945575709 2:211525855-211525877 TCCCTCCCCTTTCCACAGGAAGG - Intronic
947154259 2:227145569-227145591 GGTCACACCATTCCAAAGGATGG + Intronic
948931798 2:241136875-241136897 GCTCGCTCCTTTACCCAGGAAGG - Intronic
1168859525 20:1036188-1036210 GCTCACCCCTTTCCACCTGCAGG + Intergenic
1173590813 20:44223211-44223233 GCTCACTCATCACCACAGGATGG - Intergenic
1174786493 20:53437761-53437783 ACTCACTCATTTCCACAGGGAGG - Intronic
1175763171 20:61574701-61574723 GCTCCGGCCTCTCCACAGGTTGG + Intronic
1179488226 21:41724436-41724458 CCTCAGTCTTTTCCACAGGATGG - Intergenic
1183979650 22:41532035-41532057 GCTCAGGCCTCTCCAAAGGAAGG - Intronic
1185124493 22:48999975-48999997 GCTCACTCATTCTCACAGGAGGG - Intergenic
955387053 3:58488553-58488575 GCTCAGGCCTCTCCGCAGCAAGG - Intergenic
956694560 3:71907321-71907343 GGTCACCCCTCTACACAGGAAGG + Intergenic
962154631 3:132933130-132933152 GCTCTCTACTTTCCACAGGTGGG + Intergenic
962346136 3:134620187-134620209 GCCCACAGCTCTCCACAGGATGG - Intronic
965206118 3:165720524-165720546 GCTGACTCCTTTCCATAGGCAGG + Intergenic
967109112 3:186277719-186277741 GCTCTTTCCTTTCCACATGATGG + Intronic
968067882 3:195768922-195768944 GTTCCCGCCTTGCCCCAGGATGG + Intronic
968575900 4:1366008-1366030 TGTGACGCCATTCCACAGGAGGG + Intronic
971869352 4:32215952-32215974 GATCACTCCTCTCCACAGGTAGG + Intergenic
982181503 4:152752069-152752091 GGTAGCTCCTTTCCACAGGAAGG - Intronic
982665178 4:158252452-158252474 GCTCACACTTTTCTGCAGGATGG - Intronic
983380082 4:166981164-166981186 GGTAGCTCCTTTCCACAGGAAGG + Intronic
985916241 5:2921024-2921046 GCTAACTCCTATCCACAGGCAGG - Intergenic
986978953 5:13424066-13424088 CTTCACAGCTTTCCACAGGATGG - Intergenic
987278619 5:16389249-16389271 GCTCACTCCTTCCCAAGGGAGGG + Intergenic
988894441 5:35656923-35656945 GCTCACTACATTCCATAGGAAGG - Intronic
989730435 5:44641672-44641694 GGTAACTCCTTTCCACAGGCAGG + Intergenic
992667312 5:79023200-79023222 ATTCACGTATTTCCACAGGATGG + Intronic
993553726 5:89308782-89308804 GCTCATGGCTTTCCAAATGAAGG - Intergenic
1000286807 5:159833924-159833946 ACTCATGCCTTGCCTCAGGAGGG + Intergenic
1000514096 5:162218981-162219003 GCTCACAGCCTTCCCCAGGATGG + Intergenic
1007077150 6:39075152-39075174 GCTCAGGCCTCTGCACAGGTGGG + Intronic
1007698247 6:43747350-43747372 GTGGACCCCTTTCCACAGGACGG - Intergenic
1012387258 6:98696623-98696645 CCTGACACCTTTCCAGAGGATGG + Intergenic
1013451423 6:110285608-110285630 GCTAATGCCTTTTGACAGGAAGG - Intronic
1016814285 6:148289349-148289371 GCTCACGCCTTTCCACAGGAAGG - Intronic
1022668167 7:32430410-32430432 ACCCAGGCCTTTCCCCAGGATGG + Intergenic
1023731052 7:43192839-43192861 GCTCTTGGCTTTACACAGGAAGG + Intronic
1025204712 7:56985518-56985540 GTTCCCGCCTTTCCCCAGGAGGG - Intergenic
1025667225 7:63591417-63591439 GTTCCCGCCTTTCCCCAGGAGGG + Intergenic
1026391994 7:69911604-69911626 GGTAACTCCTTTCCACAGGCAGG + Intronic
1027687359 7:81294667-81294689 GTTAATGCCTTTCCACAGGCAGG + Intergenic
1028733301 7:94178250-94178272 GTTCTCCCTTTTCCACAGGATGG + Intergenic
1029282350 7:99444126-99444148 GCTCACACCTTCCTCCAGGAGGG - Intronic
1029658637 7:101944319-101944341 GCTCCTGCTTTTCCCCAGGAAGG + Intronic
1030922710 7:115412067-115412089 AGTCACATCTTTCCACAGGAAGG - Intergenic
1031389385 7:121194796-121194818 GCTCACTCCATTGCCCAGGATGG + Intronic
1031546663 7:123059086-123059108 GCTCAAGACTTTACCCAGGAGGG - Intergenic
1034348082 7:150399115-150399137 CCTCACGCCCTTCCAAAGCAGGG + Intronic
1034750846 7:153567717-153567739 ACTCACTCATTACCACAGGAAGG + Intergenic
1035526429 8:316734-316756 GCACACGCCCTCCCACAGGATGG - Intergenic
1035643300 8:1200003-1200025 CCCCACACTTTTCCACAGGATGG - Intergenic
1039853524 8:41393068-41393090 ACTCACTCATTACCACAGGATGG + Intergenic
1040439944 8:47430597-47430619 GCTCCTGGCATTCCACAGGATGG + Intronic
1049004773 8:139847695-139847717 GCTCATGCCCATCCACAGGCCGG - Intronic
1053919690 9:42975515-42975537 GCTCCAGCTTTTCCACAGTATGG - Intergenic
1055728164 9:79253895-79253917 GCTCACCCATTTCCACATCAGGG - Intergenic
1057668149 9:97062956-97062978 GTCCATACCTTTCCACAGGAAGG - Intergenic
1057802091 9:98196930-98196952 ACCCACCCCTCTCCACAGGAGGG + Intergenic
1196196294 X:112841084-112841106 GCTCTCGCCTTCCCACTAGAGGG + Intergenic
1196653451 X:118192627-118192649 GCTCACTCTGTTCCACAGGCTGG - Intergenic
1200749126 Y:6928953-6928975 GGTAACTCCTTTCCACAGGCAGG + Intronic