ID: 1016820677

View in Genome Browser
Species Human (GRCh38)
Location 6:148343164-148343186
Sequence GCCTCGGATGTGCCAGCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016820677_1016820688 29 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820688 6:148343216-148343238 GTATCCTGGTAAGTTACCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 109
1016820677_1016820687 28 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820687 6:148343215-148343237 GGTATCCTGGTAAGTTACCTGGG 0: 1
1: 0
2: 0
3: 12
4: 89
1016820677_1016820684 15 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820684 6:148343202-148343224 GACCGACGTGATGGGTATCCTGG 0: 1
1: 0
2: 0
3: 1
4: 19
1016820677_1016820686 27 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820686 6:148343214-148343236 GGGTATCCTGGTAAGTTACCTGG 0: 1
1: 0
2: 0
3: 1
4: 37
1016820677_1016820682 6 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820682 6:148343193-148343215 CCGACTCTGGACCGACGTGATGG 0: 1
1: 0
2: 0
3: 0
4: 22
1016820677_1016820679 -7 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820679 6:148343180-148343202 CCGAGGCGTTCTCCCGACTCTGG 0: 1
1: 0
2: 0
3: 4
4: 31
1016820677_1016820683 7 Left 1016820677 6:148343164-148343186 CCGGGTGCTGGCACATCCGAGGC 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1016820683 6:148343194-148343216 CGACTCTGGACCGACGTGATGGG 0: 1
1: 0
2: 0
3: 1
4: 14

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016820677 Original CRISPR GCCTCGGATGTGCCAGCACC CGG (reversed) Exonic
902817488 1:18924605-18924627 GCCTAGGAAGTGGCAGCGCCTGG + Intronic
903037758 1:20505180-20505202 GCCTCCTATGTGCCAGCCCCCGG - Intronic
908558743 1:65284134-65284156 GCCTCTGATGTTACAGCTCCTGG + Intronic
912062246 1:105687303-105687325 GGCTGGGTTGTGACAGCACCTGG + Intergenic
912499395 1:110112124-110112146 GCCACCTCTGTGCCAGCACCTGG - Intergenic
916660279 1:166917178-166917200 CCCTTGGAAGTGCCAGCACTGGG + Exonic
917478158 1:175386541-175386563 GACTGGGAAGTGCCATCACCTGG - Intronic
920201818 1:204264279-204264301 GCCTAGGATGAGCCAGCTGCAGG + Intronic
920786910 1:209050793-209050815 ACCTCGGATTTTCCAGGACCTGG - Intergenic
924757152 1:246951760-246951782 GGCCCAGCTGTGCCAGCACCTGG - Intronic
1063130327 10:3172550-3172572 GCCTCGGATGCGGGAGCTCCAGG + Intronic
1064282889 10:13967589-13967611 GCCTCGGATGTGCCAAGCCATGG + Intronic
1065483509 10:26216280-26216302 GCAGCGGCTGTGGCAGCACCCGG + Intergenic
1067474606 10:46557218-46557240 GCCTCGGACTTTCCAGCCCCAGG + Intergenic
1070816116 10:79324606-79324628 GACTGGGATATGCTAGCACCAGG - Intergenic
1071434994 10:85640556-85640578 GCCTCATATGTGGCAGCTCCTGG - Intronic
1073136828 10:101224862-101224884 GCCGCGGCCGTGCCCGCACCGGG + Intergenic
1074270176 10:111945560-111945582 ACCTCGGATTTTCCAGTACCTGG - Intergenic
1075070443 10:119316709-119316731 GCCATGGATGTGCCACCTCCTGG + Intronic
1080045804 11:27806356-27806378 GCCTCGGATGTGGCGGGACCTGG + Intergenic
1082263319 11:50094754-50094776 GCCTCAGATGCCCCAGAACCTGG + Intergenic
1083257079 11:61503184-61503206 GCCTAGGATGACCCAGGACCTGG + Intergenic
1084702480 11:70796398-70796420 GACTCAACTGTGCCAGCACCGGG - Intronic
1095942864 12:47737947-47737969 GCCTAGGATGTGCCAGCCATGGG + Intronic
1096198654 12:49665502-49665524 GCCTCGCTTGGCCCAGCACCAGG + Intronic
1098410795 12:70181363-70181385 ACCTCAGATGAGCCACCACCTGG - Intergenic
1099682260 12:85844077-85844099 GACTGGGCTGTGACAGCACCGGG - Intergenic
1100853664 12:98739433-98739455 GCGTTGGATTTGCCAGCACCTGG + Intronic
1103614605 12:122144138-122144160 GCCTCAGATGTTCCTGCACCTGG - Exonic
1105604238 13:21913465-21913487 GGCTGTGATGTGCTAGCACCCGG + Intergenic
1107240828 13:38231719-38231741 GCCTCGGGTTTTCCTGCACCTGG - Intergenic
1112766155 13:102746250-102746272 GCCACAGCTGAGCCAGCACCTGG - Exonic
1113956570 13:114102673-114102695 GCCTTGGCTGTGACACCACCTGG - Intronic
1114061089 14:19016270-19016292 TGCACGGATGTGCCAGCAGCAGG - Intergenic
1114101167 14:19383709-19383731 TGCACGGATGTGCCAGCAGCAGG + Intergenic
1115967900 14:38912465-38912487 GCCTTGGATTTTCCAGTACCTGG - Intergenic
1117488873 14:56226232-56226254 GCCACGCATGTGCAAGAACCTGG - Intronic
1122537062 14:102472849-102472871 GCCTCGGCAGGGGCAGCACCTGG - Intronic
1125664865 15:41422257-41422279 GCCTCAGGTGATCCAGCACCTGG + Intronic
1126225257 15:46262342-46262364 GCCTCGGATTTTCCAGTACCTGG + Intergenic
1130934674 15:88458883-88458905 GCCTCGTATGTGCCAGGCACTGG + Intergenic
1132803721 16:1766285-1766307 GCCACGGAGGTGCCAGACCCTGG + Exonic
1136718692 16:32303328-32303350 GCCAGGGATATGCCAGGACCAGG + Intergenic
1136837063 16:33509592-33509614 GCCAGGGATATGCCAGGACCAGG + Intergenic
1137574056 16:49586794-49586816 GGCTCGGAGGTCCCAGCTCCCGG - Intronic
1138479147 16:57290284-57290306 GCCTCGGGAGTGCCAGGCCCTGG + Intergenic
1138580973 16:57940199-57940221 GCCTCAGAGGTGCCAGTGCCTGG + Intronic
1141851073 16:86646475-86646497 GACTCGGATGTGACTGCCCCTGG + Intergenic
1203007739 16_KI270728v1_random:214443-214465 GCCAGGGATATGCCAGGACCAGG - Intergenic
1203123758 16_KI270728v1_random:1559398-1559420 GCCAGGGATATGCCAGGACCAGG - Intergenic
1203147240 16_KI270728v1_random:1809871-1809893 GCCAGGGATATGCCAGGACCAGG + Intergenic
1142876325 17:2853743-2853765 GCCTCGGAAATGCCCGCGCCGGG + Intronic
1143270741 17:5672814-5672836 GCCTGGGAAGAGCCAGCAACAGG - Intergenic
1144717619 17:17445405-17445427 GTCACGTAGGTGCCAGCACCTGG + Intergenic
1145090245 17:19980111-19980133 GCCTCGGCCGGGCCTGCACCGGG + Intergenic
1148245993 17:46031200-46031222 GCAGAGGATGTGCCAGGACCAGG + Exonic
1148341904 17:46878315-46878337 ACCTCGCCTGTGCCAGCTCCAGG + Intronic
1149564646 17:57632458-57632480 GCCTGTCATGTGGCAGCACCTGG - Intronic
1150983391 17:70169110-70169132 GCCTGCGAGGTGCCAGCGCCGGG - Intronic
1153783920 18:8517507-8517529 GGCTCGGGTGAGCCAGGACCCGG + Intergenic
1155091292 18:22514519-22514541 ACCTCGGATTTTCCAGTACCTGG + Intergenic
1159904640 18:74078391-74078413 GCCTGGGGTGGGCTAGCACCCGG - Intronic
1160181982 18:76644651-76644673 ACCTCGGATTTTCCAGAACCTGG + Intergenic
1163414342 19:17176877-17176899 CCCAAGCATGTGCCAGCACCAGG + Intronic
1163737068 19:18988111-18988133 GCCAGAGATGTGCCAGCAACAGG - Intergenic
1165115388 19:33525205-33525227 GGCTGGGATCTGCCAGAACCAGG - Intergenic
1167209161 19:48122362-48122384 GCCCCAGATGAGGCAGCACCTGG - Intronic
1167608831 19:50496502-50496524 GCCTCGGGTGTGCCCGCCTCGGG - Intergenic
925009358 2:470585-470607 GCCTGGGAAGTGCCAGAAGCAGG + Intergenic
925329626 2:3048562-3048584 GCCAGGTTTGTGCCAGCACCAGG + Intergenic
925689440 2:6506078-6506100 CTCTGGGATGTGCCAGCACTGGG + Intergenic
927849822 2:26491811-26491833 CCCGCAGATGTGCCAGCCCCAGG + Intronic
929280408 2:40072214-40072236 GCCTCGGATTTCCCAGTACTTGG + Intergenic
930586067 2:53268173-53268195 GCCTCAGATTTTCCAGTACCTGG - Intergenic
932090249 2:68799891-68799913 GCCTCCGATGAGCCAGCCTCAGG - Intronic
932090808 2:68804675-68804697 CCCTGCCATGTGCCAGCACCAGG - Intronic
932456815 2:71854774-71854796 GCCTTGGATTGGCCAGAACCCGG + Intergenic
934623254 2:95829261-95829283 GCCTCAGATTTTCCAGTACCTGG + Intergenic
934810511 2:97272831-97272853 GCCTCAGATTTTCCAGTACCTGG - Intergenic
934827181 2:97435108-97435130 GCCTCAGATTTTCCAGTACCTGG + Intergenic
935145155 2:100390506-100390528 GCCTGGGAAGTGCCAGGACAAGG - Intergenic
937094537 2:119226790-119226812 GCCTCCCATGTGCCAGCATCCGG + Intronic
937164109 2:119795528-119795550 GGCTGGGTTGTGACAGCACCCGG + Intronic
937397147 2:121547038-121547060 GCCTTGGATTTTCCAGTACCTGG - Intronic
938408594 2:131046111-131046133 GCCTGGGCTCCGCCAGCACCAGG - Exonic
938478463 2:131636634-131636656 TGCACGGATGTGCCAGCAGCAGG - Intergenic
940088185 2:149885613-149885635 GCCTATCATGTGCCAGCTCCAGG + Intergenic
940674759 2:156714548-156714570 ACCTCGGATTTTCCAGGACCTGG + Intergenic
947910042 2:233794718-233794740 GCCTCCGAGGGACCAGCACCTGG - Intronic
1169514176 20:6298218-6298240 TCCTCTGATCTGTCAGCACCGGG - Intergenic
1170807712 20:19647445-19647467 GGCATTGATGTGCCAGCACCCGG - Intronic
1172258114 20:33536706-33536728 GTCTGGGATGTGAGAGCACCCGG - Intronic
1175305680 20:57974050-57974072 GCCTGGCAGGAGCCAGCACCTGG - Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1176866071 21:14055920-14055942 GCCAGGGATGTGGCAGGACCAGG + Intergenic
1177386811 21:20419640-20419662 GCCTCAGATGAGCCAACAGCTGG + Intergenic
1178354718 21:31900980-31901002 GCCACGGAAGTGCCAGAAGCTGG - Intronic
1179374917 21:40841725-40841747 GCCTCGGAGGTGGCAGCTCCGGG - Intronic
1179400186 21:41076209-41076231 GCCAGCGCTGTGCCAGCACCTGG + Intergenic
1179486481 21:41713895-41713917 GCCTGGGATGGGCTAGGACCCGG - Intergenic
1180479572 22:15738882-15738904 TGCACGGATGTGCCAGCAGCAGG - Intergenic
1184100695 22:42340509-42340531 TCCTGGGAGGTGGCAGCACCAGG + Intronic
950094508 3:10321076-10321098 GTCTCGGACGTGGCAGCTCCCGG + Exonic
952925472 3:38316540-38316562 TCCTGGGCTGTGCCAGCACGGGG + Intronic
953361366 3:42300254-42300276 TTCTGGGATGTGCCTGCACCTGG - Intergenic
954028655 3:47802939-47802961 GCCCGGGATGCCCCAGCACCCGG - Exonic
955217569 3:56997180-56997202 GCCTCTGATGACCCAGCCCCAGG + Intronic
958590713 3:96154903-96154925 GCCTTGGATTTTCCAGTACCTGG - Intergenic
961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG + Intronic
962232326 3:133676503-133676525 GCCTCAGACGTGACAGAACCAGG - Intergenic
967644752 3:191908969-191908991 GACTCGTATGTGCCAGATCCCGG + Intergenic
968973464 4:3809078-3809100 CCCTCGGAGGCGGCAGCACCCGG + Intergenic
971105971 4:23524584-23524606 GCCTCAGATTTCCCAGCACCTGG - Intergenic
971605349 4:28651448-28651470 GCCTCAGATTTTCCAGCACTTGG + Intergenic
975106216 4:70571753-70571775 ACCTCGGATTTTCCAGTACCTGG + Intergenic
977649569 4:99454257-99454279 TCCTCGGATTTTCCAGTACCTGG + Intergenic
982133169 4:152248089-152248111 ACCCCTCATGTGCCAGCACCTGG + Intergenic
982288221 4:153756636-153756658 GCCTCCCATGTGCCAGCCACTGG + Intronic
987015855 5:13818578-13818600 GCCTCGGATGAAGTAGCACCTGG + Intronic
990500274 5:56389789-56389811 ACCTCGGATTTTCCAGAACCTGG - Intergenic
994406625 5:99352945-99352967 GGCTGGGTTGTGACAGCACCTGG + Intergenic
994470104 5:100192611-100192633 GCCTGGGATTTTCCAGTACCTGG - Intergenic
994517904 5:100793983-100794005 GGCTGGGTTGTGACAGCACCTGG - Intergenic
995187787 5:109290030-109290052 GCCTTGGATTTTCCAGTACCTGG - Intergenic
1000854309 5:166379655-166379677 GGCTGGGTTGTGACAGCACCGGG + Intergenic
1001117727 5:168953687-168953709 GCCACGGATGTGCCAGGCACTGG - Intronic
1002289027 5:178187260-178187282 GCCTCGGCTGGCCCAGCACCCGG + Intergenic
1008014480 6:46502916-46502938 GGCTGGGCTGTGCCAGCAACAGG + Intergenic
1014183250 6:118407833-118407855 ACCTCAGATGTTCCAGTACCTGG - Intergenic
1014688484 6:124532667-124532689 GCCTCTGACGAGCCAGCATCTGG - Intronic
1015927441 6:138324120-138324142 GGCTCGGATGCGCCAGTACTCGG - Exonic
1016820677 6:148343164-148343186 GCCTCGGATGTGCCAGCACCCGG - Exonic
1018186344 6:161268183-161268205 GCCTCCTATGTGCCAGTACATGG - Intronic
1019219083 6:170460813-170460835 GCCTCTGATGTGCAGGCCCCCGG - Intergenic
1019563414 7:1668696-1668718 GCCTGGGATGTGCCAGGCCTGGG - Intergenic
1019568655 7:1697472-1697494 GCCTCGGCTGTGCCGGGACCTGG - Intronic
1019595790 7:1857741-1857763 GCCTCAGATGTAGCAGGACCAGG - Intronic
1023254812 7:38302378-38302400 GCCCTGGCTGTGGCAGCACCAGG - Intergenic
1023886413 7:44360366-44360388 ACCTCAGATTTTCCAGCACCTGG + Intergenic
1025910102 7:65821351-65821373 GCCTCAGCTGTACCAGTACCTGG - Intergenic
1026402564 7:70029969-70029991 TCTTTGGATGTGGCAGCACCTGG - Intronic
1026583036 7:71633773-71633795 GCCTTGGATTTGCCAGCAGCTGG - Intronic
1028176987 7:87671517-87671539 GCCTCGGATTTTCTAGTACCTGG + Intronic
1030243735 7:107359272-107359294 GGCTGAGATGTGACAGCACCTGG - Intronic
1035478206 7:159158768-159158790 GCCTCAGCAGTGCCAGAACCCGG - Intergenic
1035478228 7:159158847-159158869 GCCTCAGCTGTGCCAGCACCCGG - Intergenic
1035686817 8:1529573-1529595 GCCTTGGGTTTGACAGCACCTGG - Intronic
1038437079 8:27543799-27543821 TCCTCAGATGTCCCAGCACATGG + Exonic
1041244852 8:55880162-55880184 GCCGCGGCTGTGCCACCAGCCGG + Intronic
1045594327 8:103635512-103635534 ACCTCGGATCTTCCAGAACCTGG + Intronic
1049169482 8:141150164-141150186 GCCTCCCACGTGCCAGCACCCGG + Intronic
1049825898 8:144667539-144667561 CCCTGGGATGTCCCGGCACCTGG + Intergenic
1051579459 9:18655028-18655050 GCCTCAGATGGGCCAGCAAGGGG - Intronic
1052654305 9:31335384-31335406 GACTGGGCTGTGACAGCACCTGG + Intergenic
1060044353 9:120327932-120327954 CCCTCTGAAGGGCCAGCACCTGG - Intergenic
1061181391 9:129027080-129027102 CCCTGGGATGGGCCAGCCCCGGG + Intronic
1061671124 9:132188710-132188732 GCCTCGGTGGTGCCAGCTCATGG - Intronic
1062450923 9:136615408-136615430 GCCTCGGAAGAGCCAGCCCTTGG - Intergenic
1188562561 X:31485975-31485997 GCCTGGGCTGGGCCAGAACCTGG + Intronic
1188714970 X:33449394-33449416 ACCTCGGATTTTCCAGTACCTGG - Intergenic
1189101094 X:38190746-38190768 ACCTAGGAAGTGCTAGCACCAGG - Intronic
1191988831 X:67010299-67010321 GCCTTGGATTTTCCAGTACCTGG - Intergenic
1192920781 X:75703506-75703528 GCCTCAGATTTTCCAGTACCTGG - Intergenic
1193739716 X:85203110-85203132 ACCTCGGATTTTCCAGAACCTGG + Intergenic
1193789163 X:85797532-85797554 GCCTCGAATTTTCCAGCACCTGG + Intergenic
1194247896 X:91537804-91537826 GCCTCAGATTTTCCAGTACCTGG - Intergenic
1194781499 X:98029557-98029579 GCCTCGAATTTTCCAGTACCTGG + Intergenic
1196227972 X:113188842-113188864 GCCTCAGATTTTCCAGTACCTGG + Intergenic
1198648565 X:138836966-138836988 GACTTGGATTTGCCAGTACCTGG + Intronic
1201159941 Y:11158785-11158807 GTGTCGGCTGTGCCAGCGCCTGG + Intergenic
1202115466 Y:21466667-21466689 GCCTCTGATCTGCCGGAACCTGG + Intergenic