ID: 1016820714

View in Genome Browser
Species Human (GRCh38)
Location 6:148343317-148343339
Sequence GAAGGACGCCTCTGCGGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016820714_1016820719 -4 Left 1016820714 6:148343317-148343339 CCCACTCCGCAGAGGCGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1016820719 6:148343336-148343358 CTTCTCTGGCTCTAGTTCTTAGG 0: 1
1: 0
2: 2
3: 55
4: 477
1016820714_1016820721 -2 Left 1016820714 6:148343317-148343339 CCCACTCCGCAGAGGCGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1016820721 6:148343338-148343360 TCTCTGGCTCTAGTTCTTAGGGG 0: 1
1: 0
2: 7
3: 118
4: 1831
1016820714_1016820722 -1 Left 1016820714 6:148343317-148343339 CCCACTCCGCAGAGGCGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1016820722 6:148343339-148343361 CTCTGGCTCTAGTTCTTAGGGGG 0: 1
1: 0
2: 1
3: 30
4: 260
1016820714_1016820723 19 Left 1016820714 6:148343317-148343339 CCCACTCCGCAGAGGCGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1016820723 6:148343359-148343381 GGGCTAAATACACACAGTATAGG 0: 1
1: 0
2: 1
3: 6
4: 61
1016820714_1016820720 -3 Left 1016820714 6:148343317-148343339 CCCACTCCGCAGAGGCGTCCTTC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1016820720 6:148343337-148343359 TTCTCTGGCTCTAGTTCTTAGGG 0: 1
1: 0
2: 2
3: 64
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016820714 Original CRISPR GAAGGACGCCTCTGCGGAGT GGG (reversed) Intronic
901138193 1:7011117-7011139 GAAGGAAGCCACTGCAGACTTGG + Intronic
904946256 1:34200845-34200867 GAAGGACGCCTGTGGTGAGGAGG + Exonic
906943278 1:50274368-50274390 GCAGGAGGCCTCTGCGTAGTAGG - Intergenic
907904211 1:58769466-58769488 CAAGGAGCCCCCTGCGGAGTTGG + Intergenic
921225431 1:213015221-213015243 GGAGGCCGCCTCTCCGCAGTAGG - Intronic
1075454756 10:122577900-122577922 GCAGGAGGGCTCTGTGGAGTAGG - Intronic
1075456903 10:122590755-122590777 GAAGGAGGGCTCTGTGGAATGGG - Intronic
1076039042 10:127227301-127227323 TAAGGATGCCTGTGGGGAGTAGG + Intronic
1076809983 10:132881435-132881457 AAAGGAGGCCTCTGCAGGGTAGG + Intronic
1088256554 11:107908710-107908732 GAAGGAGGAGTCTGAGGAGTCGG + Intronic
1089351834 11:117825700-117825722 GAAGGAGGTCACAGCGGAGTGGG - Intronic
1096424177 12:51487114-51487136 GAAGAACGCCTCTGGGAGGTAGG + Intronic
1102909950 12:116705687-116705709 GTTGCACGCCACTGCGGAGTTGG - Intergenic
1105350141 13:19607591-19607613 GAAGGAGGCTTCTGGGGTGTGGG - Intergenic
1106497444 13:30293427-30293449 GAAGGATCCTTCTGGGGAGTTGG - Intronic
1113494151 13:110714388-110714410 GAGGGCCGCCGCTGCGGAGCCGG - Intronic
1113634024 13:111907669-111907691 GAAGGTCACATCTGAGGAGTCGG + Intergenic
1115437165 14:33387971-33387993 GAAGGAAGCCTCTAAGGAGAAGG + Intronic
1122532647 14:102439658-102439680 GAAGGACGCCTCAACTGAGCAGG - Intronic
1137223891 16:46482993-46483015 GAAGCAGGCCTCTGAGGAGGGGG - Intergenic
1143917654 17:10305650-10305672 GGAGGAGGGCTCTGCGGAGGAGG - Intronic
1151675719 17:75596392-75596414 GAAGGAAGCCTCTGGGGTGGGGG + Intergenic
1152299558 17:79487101-79487123 GAAGGAAGCCTCTGGGGATGAGG + Intronic
1160402306 18:78620012-78620034 GTAGGACACCTCTGCGGTGGAGG - Intergenic
1163310185 19:16509609-16509631 AAAGGCCGCCTCTGCAGAGGGGG + Exonic
1163573968 19:18099656-18099678 GAGGGACGCCTGTGCTGGGTTGG - Intronic
1164855308 19:31516483-31516505 GAAGCAGGGCTTTGCGGAGTGGG - Intergenic
1166025732 19:40082909-40082931 GAAGGAGGCCATTGTGGAGTAGG + Intronic
1167117519 19:47496842-47496864 TAAGCACTCCTCTGGGGAGTGGG + Intronic
1167169452 19:47821669-47821691 GAAGGACTTCCCTGAGGAGTAGG + Intronic
925844710 2:8024780-8024802 GAAGGACGCCTCTGCGACTGGGG - Intergenic
926145299 2:10393586-10393608 GAAAGATGCCTCTGTGGAGCTGG + Intronic
926695305 2:15766642-15766664 GAAAGAAGCCGCTGCGGTGTGGG + Intergenic
927652486 2:24920603-24920625 GAAGGAAGCCGCGGCGGAGGAGG - Intergenic
934156668 2:89207446-89207468 GAAGGATGCCTGTGTGGGGTGGG + Intergenic
934210648 2:89975305-89975327 GAAGGATGCCTGTGTGGGGTGGG - Intergenic
936345427 2:111671944-111671966 GTAGGAGGCCTCTGTGGAGTGGG + Intergenic
936476576 2:112844922-112844944 GCAGAAAGCCTGTGCGGAGTGGG - Intergenic
937111063 2:119367409-119367431 GCAGGACGTCGCGGCGGAGTGGG + Intronic
942713630 2:178866158-178866180 GAATGGCGTCTCTGAGGAGTTGG - Intronic
946191954 2:218012071-218012093 GAAGGCCCCCTCTGCAGACTTGG - Intergenic
1172700763 20:36852335-36852357 GAAGGGCTGCTCTGTGGAGTGGG + Intronic
1174427479 20:50442634-50442656 GCAGAACGCCTCTGAGAAGTTGG - Intergenic
1176306014 21:5123532-5123554 GAAGGAGGCCTCTGAGGTTTCGG + Intronic
1179851043 21:44138499-44138521 GAAGGAGGCCTCTGAGGTTTCGG - Intronic
1183281356 22:36934328-36934350 GAAGGAGGCCTGAGTGGAGTGGG - Intronic
950005055 3:9686205-9686227 CACGGAGGCCTCTGAGGAGTAGG - Intronic
954581585 3:51706170-51706192 GAAGGACGCCCCTGGGTAGAGGG - Intergenic
956596888 3:70977078-70977100 GAATGACGACTCTGCTGATTTGG - Intronic
958925241 3:100150050-100150072 GAAGGAGGCCACAGGGGAGTTGG - Intronic
959092092 3:101913995-101914017 GAAGGAGGCTTCTGGGGAGCTGG - Intergenic
961678549 3:128583445-128583467 GAAAGAGGCCCCTGCAGAGTGGG + Intergenic
967596118 3:191328622-191328644 GAAGCTCACCTCTGAGGAGTGGG + Exonic
969049699 4:4363937-4363959 AGAGGACTCCTCTGAGGAGTGGG - Intronic
974360197 4:60867719-60867741 GAGGGAAGACTCTGAGGAGTTGG + Intergenic
977356593 4:95954136-95954158 GAAGGATGCCTCTGAGGATGTGG + Intergenic
978760820 4:112355515-112355537 GAAGGATGCCTCTGGGGAGGAGG + Intronic
979934876 4:126679469-126679491 CAAGGAGGCTTCTGAGGAGTTGG + Intergenic
985753877 5:1701416-1701438 GCAGGCCGACTCTGCGGTGTTGG - Intergenic
989609835 5:43280315-43280337 GAAGGACTCCTCGGATGAGTCGG - Exonic
998896454 5:146805262-146805284 GAAGGATGCTTCTGCGGTCTAGG - Intronic
1000026406 5:157362808-157362830 GAAGGACTTCTCTGGGGAGATGG + Intronic
1002503720 5:179664612-179664634 GAAGGAAGCCTATGCTGAGACGG - Intergenic
1002820291 6:718488-718510 GTCAGACGCCTTTGCGGAGTGGG + Intergenic
1007386445 6:41523358-41523380 GAGGGACCCCTCTGGGGAGCTGG + Intergenic
1007742362 6:44020674-44020696 GGAGGAGGCCTCTGCTGACTTGG + Intergenic
1008051302 6:46902810-46902832 CAATGAAGCCTCTGAGGAGTTGG + Intronic
1009354129 6:62719549-62719571 GAAGGATGCCTGTGGGCAGTGGG - Intergenic
1015637304 6:135290021-135290043 GAAGGAGCCATCTGCGGTGTCGG - Intronic
1016820714 6:148343317-148343339 GAAGGACGCCTCTGCGGAGTGGG - Intronic
1019306875 7:339818-339840 GAGGGCCGCCTCTGGGGAGGAGG - Intergenic
1024006888 7:45231199-45231221 GAGGGACGCCTCAGGGGACTTGG - Intergenic
1028290370 7:89057710-89057732 GAAGCAGGCCACTGTGGAGTGGG + Intronic
1034541114 7:151758890-151758912 GAAGGAGGTCTCTGAGGAGGCGG + Intronic
1054958472 9:70940684-70940706 GAAGGACTTCTCTGAGGAGATGG + Intronic
1061497393 9:130982793-130982815 GGAGGACGCCACCGCGGAGAAGG + Intergenic
1062129929 9:134886789-134886811 GAAGGAAGTCTCTGCAGAGCAGG + Intronic
1196822086 X:119709682-119709704 GAAGGACCCCTTTGAGAAGTTGG - Intergenic
1200980988 Y:9263172-9263194 GAAGGAAACATCTGCGGAGGTGG - Intergenic
1202129439 Y:21596565-21596587 GAAGGAAACATCTGCGGAGGTGG + Intergenic