ID: 1016822602

View in Genome Browser
Species Human (GRCh38)
Location 6:148360734-148360756
Sequence CTGCAGTTATTTATGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016822600_1016822602 12 Left 1016822600 6:148360699-148360721 CCTAGTAATAAGAGTAAGGATAA 0: 1
1: 0
2: 2
3: 22
4: 220
Right 1016822602 6:148360734-148360756 CTGCAGTTATTTATGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016822602 Original CRISPR CTGCAGTTATTTATGGAGCA TGG Intronic
No off target data available for this crispr