ID: 1016824784

View in Genome Browser
Species Human (GRCh38)
Location 6:148378224-148378246
Sequence TTGTATTTTCAGTAAAGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359945
Summary {0: 3, 1: 229, 2: 8907, 3: 122382, 4: 228424}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016824776_1016824784 27 Left 1016824776 6:148378174-148378196 CCGGAGTAGCTGGGATTACAGGC 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
Right 1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG 0: 3
1: 229
2: 8907
3: 122382
4: 228424
1016824778_1016824784 -1 Left 1016824778 6:148378202-148378224 CCACCATGCCTGGCTAATTTTTT 0: 14129
1: 68768
2: 138540
3: 195157
4: 181262
Right 1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG 0: 3
1: 229
2: 8907
3: 122382
4: 228424
1016824780_1016824784 -9 Left 1016824780 6:148378210-148378232 CCTGGCTAATTTTTTTGTATTTT 0: 15212
1: 17469
2: 21303
3: 48467
4: 228516
Right 1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG 0: 3
1: 229
2: 8907
3: 122382
4: 228424
1016824774_1016824784 30 Left 1016824774 6:148378171-148378193 CCTCCGGAGTAGCTGGGATTACA 0: 2060
1: 108993
2: 251093
3: 226006
4: 155652
Right 1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG 0: 3
1: 229
2: 8907
3: 122382
4: 228424
1016824779_1016824784 -4 Left 1016824779 6:148378205-148378227 CCATGCCTGGCTAATTTTTTTGT 0: 2532
1: 12412
2: 49055
3: 101808
4: 166452
Right 1016824784 6:148378224-148378246 TTGTATTTTCAGTAAAGGCGGGG 0: 3
1: 229
2: 8907
3: 122382
4: 228424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016824784 Original CRISPR TTGTATTTTCAGTAAAGGCG GGG Intronic
Too many off-targets to display for this crispr