ID: 1016826240

View in Genome Browser
Species Human (GRCh38)
Location 6:148390882-148390904
Sequence TCTAAGCCCAAAGGGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016826237_1016826240 4 Left 1016826237 6:148390855-148390877 CCAGTGTATACTACATTTTTTAT No data
Right 1016826240 6:148390882-148390904 TCTAAGCCCAAAGGGTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016826240 Original CRISPR TCTAAGCCCAAAGGGTGTCT AGG Intronic