ID: 1016826812

View in Genome Browser
Species Human (GRCh38)
Location 6:148396024-148396046
Sequence ACTCATCAGCAGCTGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016826810_1016826812 5 Left 1016826810 6:148395996-148396018 CCCAGCAGCACTCTGTTGATGAT 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263
1016826811_1016826812 4 Left 1016826811 6:148395997-148396019 CCAGCAGCACTCTGTTGATGATG 0: 1
1: 0
2: 1
3: 14
4: 146
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263
1016826806_1016826812 12 Left 1016826806 6:148395989-148396011 CCCTACCCCCAGCAGCACTCTGT 0: 1
1: 0
2: 1
3: 35
4: 321
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263
1016826807_1016826812 11 Left 1016826807 6:148395990-148396012 CCTACCCCCAGCAGCACTCTGTT 0: 1
1: 0
2: 1
3: 37
4: 316
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263
1016826809_1016826812 6 Left 1016826809 6:148395995-148396017 CCCCAGCAGCACTCTGTTGATGA 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263
1016826808_1016826812 7 Left 1016826808 6:148395994-148396016 CCCCCAGCAGCACTCTGTTGATG 0: 1
1: 0
2: 1
3: 10
4: 154
Right 1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG 0: 1
1: 0
2: 2
3: 35
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016826812 Original CRISPR ACTCATCAGCAGCTGAAGCC TGG Intronic
904463420 1:30693742-30693764 ACTCATCAGAGGCTCCAGCCAGG + Intergenic
904627469 1:31815102-31815124 CCTCAGCAGCACCTGCAGCCCGG + Exonic
904644951 1:31958646-31958668 CCTCATCATGACCTGAAGCCTGG + Intergenic
906050618 1:42868339-42868361 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
906565597 1:46799026-46799048 ACCCAGGAGCAGCTGAAGGCAGG + Exonic
906930792 1:50167596-50167618 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
907780471 1:57561764-57561786 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
908553037 1:65229095-65229117 GGTCACCAGCAGCAGAAGCCTGG - Exonic
909172473 1:72314536-72314558 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
909466575 1:75980128-75980150 CCTCATCAGCAGCTGCTGCTTGG - Intergenic
910515409 1:88054594-88054616 AATAATCAGCAGCAGTAGCCAGG - Intergenic
911257209 1:95646433-95646455 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
911738268 1:101361002-101361024 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
912129781 1:106587128-106587150 ACTCAGCAGCAGCCGTAGCCAGG + Intergenic
912257149 1:108071824-108071846 ACTCACCATCAGCTGTAACCAGG + Intergenic
912873149 1:113328237-113328259 AATAATCAGCAGCAGTAGCCAGG - Intergenic
913126142 1:115792190-115792212 CTTCATCAGCAGCTGGAGGCAGG - Intergenic
914267014 1:146046801-146046823 CTTCTTCAGCAGCTGAAGCCTGG + Intergenic
915584515 1:156837098-156837120 CCTCAGCTGCAGCTGATGCCTGG - Intronic
915667549 1:157458744-157458766 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
916106065 1:161433369-161433391 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
916210267 1:162354596-162354618 TCTCACCAACAGCAGAAGCCAGG - Intronic
916369969 1:164081035-164081057 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
917460301 1:175223463-175223485 ACTCATCAACAGGTGAAGGGTGG + Intergenic
918013672 1:180611481-180611503 CCTCTTTAGCAGCTGAAGGCAGG - Intergenic
918918108 1:190670956-190670978 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
920847771 1:209607949-209607971 ACTTCTCATCAGCTGAACCCAGG - Intronic
922619506 1:226981321-226981343 ACTCAGGAGCAGCAGAAGGCCGG - Intronic
922792688 1:228318813-228318835 ACTGATAAGCAGCTGAGGTCTGG + Intronic
1066287535 10:33982663-33982685 GCTCATCAGCTTCTGGAGCCTGG + Intergenic
1066758131 10:38730562-38730584 ACTCCTCAGCCGCTGAGGCCTGG - Intergenic
1066963560 10:42242135-42242157 GCTCCTCAGCCGCTGAGGCCCGG + Intergenic
1067519068 10:46981400-46981422 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1067643177 10:48070434-48070456 ACTCAGTAGCAGCTGTAGCCAGG + Intergenic
1069200515 10:65609374-65609396 ACTCATCTGCTGATGAACCCAGG - Intergenic
1071364354 10:84883594-84883616 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1071896758 10:90076171-90076193 AATCATCAGAAGCTGTAGCCAGG - Intergenic
1075393486 10:122110505-122110527 ACTCATTAGAAGATGAAGTCAGG - Intronic
1076016906 10:127034999-127035021 TCTCAGCAGCAGCTGTTGCCAGG + Intronic
1076177728 10:128381221-128381243 GCACAACAGCAGGTGAAGCCAGG - Intergenic
1076853220 10:133103142-133103164 CCACATCTGCAGCTGGAGCCCGG + Intronic
1077422302 11:2458508-2458530 CCTCACCAGGAGCTGGAGCCTGG - Intronic
1077434509 11:2532351-2532373 ACGCAGGGGCAGCTGAAGCCGGG - Intronic
1080115620 11:28618494-28618516 ACTGCTCAGCAACAGAAGCCTGG - Intergenic
1082013499 11:47467160-47467182 ACCCACCAGCAGCTTAAGTCTGG + Intronic
1082748702 11:56995686-56995708 TCTCATCTGCTTCTGAAGCCTGG + Intergenic
1083167231 11:60898172-60898194 AGTCATCAGCCGCTGTAGCCAGG + Exonic
1084685815 11:70694575-70694597 ACTAATGAGCAGCAGAAACCTGG - Intronic
1086141502 11:83505298-83505320 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1086470730 11:87106863-87106885 ACTCCCCAGAAGCTGATGCCAGG - Intronic
1087374142 11:97321449-97321471 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1088191524 11:107233591-107233613 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1088449475 11:109966257-109966279 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1090221480 11:125030697-125030719 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1091059215 11:132445795-132445817 ACTTCTCAGCAGAGGAAGCCTGG - Intronic
1092593260 12:9971120-9971142 ACTAATCTGCAGCTGTGGCCTGG - Intronic
1092837088 12:12500806-12500828 TAGCATCAGCAGCTGTAGCCAGG - Intronic
1093031735 12:14295030-14295052 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1094102660 12:26780167-26780189 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
1094172175 12:27505133-27505155 ATTCATCAGCATCTCAAGCTGGG + Intergenic
1096480541 12:51937920-51937942 ACTCAACAGCAGATGAGGCCAGG + Intergenic
1096576963 12:52558880-52558902 CCTCCTCAGCAGATGAACCCAGG + Intergenic
1096684286 12:53277592-53277614 CCTCACCAGCATCTGCAGCCAGG - Exonic
1096735098 12:53647031-53647053 ACTCAGCAGCAGTGGTAGCCTGG - Intronic
1098736606 12:74112875-74112897 AATAATCAGCAGCAGTAGCCAGG - Intergenic
1098831783 12:75373127-75373149 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1099375774 12:81894854-81894876 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1099490548 12:83283347-83283369 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1099508696 12:83508089-83508111 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1099735913 12:86565940-86565962 ACTCAGCGGTAGCTGTAGCCAGG - Intronic
1100199674 12:92284828-92284850 ATTTATCAACAGCTGGAGCCTGG + Intergenic
1100566061 12:95795179-95795201 AGGAATGAGCAGCTGAAGCCAGG - Intergenic
1101534484 12:105604851-105604873 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1103396662 12:120612352-120612374 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
1103546079 12:121702663-121702685 ACTCATCAGCAACCGGAGGCTGG - Intergenic
1104434686 12:128746476-128746498 AATCAATAGCAGCTGAAGACTGG + Intergenic
1104973192 12:132540692-132540714 ACACATCAGCACCTGGAACCAGG + Intronic
1108730449 13:53229913-53229935 ACTCATCAGCAGGTAAGTCCTGG - Intergenic
1109747637 13:66647531-66647553 AATAATCAGCAGCGGTAGCCAGG + Intronic
1110466988 13:75813517-75813539 ACTGTACAGCAGCTGGAGCCAGG - Intronic
1110834013 13:80063725-80063747 ACTCAACAGTGGCTGTAGCCAGG + Intergenic
1113780622 13:112974755-112974777 TTTCATGAGCAGCTGAAGCCTGG - Intronic
1114775986 14:25482048-25482070 CCTCATAAACAACTGAAGCCAGG - Intergenic
1115829958 14:37326618-37326640 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1116218642 14:42053430-42053452 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1117637921 14:57766063-57766085 ACTCATCAAGAGCTGTACCCTGG - Intronic
1117779998 14:59222503-59222525 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1120498282 14:85262679-85262701 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1120866455 14:89299495-89299517 ACTCCTGAGGAGCTGAAACCTGG + Intronic
1125089112 15:35770218-35770240 ACTCCTCTTCATCTGAAGCCTGG + Intergenic
1126247558 15:46527150-46527172 AGTGATCACCATCTGAAGCCAGG + Intergenic
1127755957 15:62092266-62092288 CCTCTTCAGCATCTGAAGACGGG + Intergenic
1128375342 15:67070340-67070362 ACTCAGCTGCAGCTGAACCTAGG + Intronic
1129172286 15:73815560-73815582 ACTTATTAGCAGCAAAAGCCAGG + Intergenic
1135147435 16:19974840-19974862 ACTCAGCAGCAGCAGTAGCCTGG + Intergenic
1136724707 16:32348624-32348646 ACTCCTCAGCCGCTGAGGCCCGG + Intergenic
1136843034 16:33554664-33554686 ACTCCTCAGCCGCTGAGGCCCGG + Intergenic
1137712130 16:50573764-50573786 AATCACCAGGAGCTGAACCCAGG - Intronic
1139134339 16:64183260-64183282 ACTCAACATCAGCTAAGGCCTGG - Intergenic
1141054377 16:80803303-80803325 ACTCATTAGGACCTGGAGCCAGG + Intronic
1141346814 16:83254157-83254179 ACTCATAACCACCTGATGCCTGG - Intronic
1203001723 16_KI270728v1_random:169131-169153 ACTCCTCAGCCGCTGAGGCCCGG - Intergenic
1203133326 16_KI270728v1_random:1705537-1705559 ACTCCTCAGCCGCTGAGGCCCGG - Intergenic
1203153199 16_KI270728v1_random:1854962-1854984 ACTCCTCAGCCGCTGAGGCCCGG + Intergenic
1149518837 17:57303022-57303044 TCTGATCACCAGCTGGAGCCTGG - Intronic
1149567478 17:57650337-57650359 TCTTAACAGCAGCAGAAGCCTGG + Intronic
1151008557 17:70466054-70466076 ACTCCTCAGCCTCTGAAGTCTGG - Intergenic
1151385118 17:73750485-73750507 CCTCATCAGCAGTGGAAACCGGG - Intergenic
1152037425 17:77881747-77881769 GCTCAGCAGCAGCTGCGGCCAGG + Intergenic
1152412302 17:80133639-80133661 TCTCATCAGGAGCTGCTGCCAGG - Intergenic
1152417442 17:80171751-80171773 CCTCACCAGCAGCTGAAGACAGG - Intronic
1153363291 18:4224172-4224194 AATAATCAGCAGCAGTAGCCAGG + Intronic
1153553102 18:6282969-6282991 GCCCATCAGCAGCACAAGCCAGG - Intronic
1154068596 18:11131984-11132006 ACTCAGCAGCGGCTGCAGCCAGG - Intronic
1157369816 18:47100408-47100430 TCTCACCAGCAGATGGAGCCTGG + Intronic
1157870813 18:51228693-51228715 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1158539758 18:58342418-58342440 ACTTATCAGCATCTGGACCCAGG - Intronic
1161446106 19:4320164-4320186 CCTCAGCAGTAGCTGAGGCCTGG + Intronic
1164145741 19:22511477-22511499 AGCCATGAGCACCTGAAGCCTGG + Intronic
1166109747 19:40614664-40614686 CCCCCTCTGCAGCTGAAGCCCGG + Intronic
1167465550 19:49649348-49649370 ACCCAGCAGCAGGTGCAGCCTGG + Intronic
1168539204 19:57196504-57196526 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
925545211 2:5008643-5008665 ATACATCAGCTGCTGAAGACAGG - Intergenic
926758323 2:16253488-16253510 CCTCATCAGCAGGTGGAGACCGG + Intergenic
927703910 2:25285546-25285568 ACTCCTCAGCAGTTGGAGGCAGG + Intronic
928552317 2:32384677-32384699 AATCAGCAACAGCTGTAGCCTGG + Intronic
928877289 2:36054800-36054822 ACACTTCAGCAGCTGTAGCTTGG + Intergenic
929269700 2:39959897-39959919 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
930295082 2:49544473-49544495 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
930921100 2:56754740-56754762 CCTCACCAGCAGCTGATGCCAGG - Intergenic
931228977 2:60358170-60358192 GCTCATAAACAGCTGCAGCCTGG - Intergenic
932595280 2:73089469-73089491 TCTCAGCTGCATCTGAAGCCTGG - Intronic
932975797 2:76598101-76598123 ACTCAGCAGTACCTGTAGCCAGG - Intergenic
933777137 2:85777960-85777982 ACCCATCAGCAACTCAAGACAGG - Intronic
933926420 2:87094307-87094329 TCTCAGCAGCAGCCGCAGCCTGG - Intergenic
934321444 2:91975002-91975024 GCTCCTCAGCCGCTGAGGCCTGG - Intergenic
935434356 2:103012852-103012874 ATTTATCAGAAGCTGCAGCCTGG - Intergenic
936511304 2:113149761-113149783 AATAATCAGCAGCTGTAGGCAGG - Intergenic
938204050 2:129402059-129402081 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
939227427 2:139381814-139381836 ACTCAATAGCACCTGTAGCCAGG + Intergenic
939788553 2:146545215-146545237 ACTCAGCAGCAGCCATAGCCAGG + Intergenic
940359400 2:152781438-152781460 ACTCAGCAGTGGCTGCAGCCAGG + Intergenic
940802971 2:158153769-158153791 AATTATCAGCAGCAGTAGCCAGG + Intergenic
941330534 2:164173662-164173684 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
943101378 2:183491140-183491162 ATTTGTCAGCAGCTGAAGCCTGG - Intergenic
943317797 2:186411416-186411438 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
943517468 2:188906354-188906376 ACTCAGCAGTGGCTGTAGCCTGG + Intergenic
945446071 2:209940099-209940121 AGTCATCAGCAGTTGAAGCGTGG + Intronic
947440973 2:230121155-230121177 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
947521288 2:230848043-230848065 ACTCAACAGTAGCAGAAGCGCGG + Intergenic
948454421 2:238098164-238098186 CCTCAGCAGCAGCTGCAGCTCGG + Intronic
948970160 2:241419309-241419331 ACTCATCAGCAGGTGTAGGCAGG - Intronic
1169910271 20:10642456-10642478 ACCCATGGGCAGCTGAAGCCTGG + Intronic
1170769550 20:19320001-19320023 ACTTCTCAGCAGCTGCAGCATGG + Intronic
1170864120 20:20137914-20137936 AATAATCAGCAGCAGTAGCCAGG - Intronic
1172011387 20:31848075-31848097 ACTCAACAGCAGGTTAAGGCTGG + Intronic
1172103031 20:32497169-32497191 ACGCTTCAGCAGCTGATGTCTGG - Intronic
1172808596 20:37631300-37631322 AATCATCAGTAGCTGCAGGCAGG - Intergenic
1173539219 20:43838752-43838774 AATCAGCAGCAGCTGAGGACAGG + Intergenic
1174097691 20:48102341-48102363 GCTCATAAGCAGCTACAGCCAGG - Intergenic
1178012788 21:28306081-28306103 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1179983181 21:44907030-44907052 CCTCATGAGCAGCTGTGGCCGGG + Exonic
1180309698 22:11158971-11158993 GCTCCTCAGCCGCTGAGGCCTGG - Intergenic
1180548175 22:16520781-16520803 GCTCCTCAGCCGCTGAGGCCTGG - Intergenic
1181422772 22:22813279-22813301 ACTCAGCAGTAGCTACAGCCAGG + Intronic
1182505631 22:30780322-30780344 ACTCCTCAGCAGCTGTGGCATGG - Intronic
1184805997 22:46795261-46795283 ACCCATGAGCAGATGAAGCCAGG - Intronic
949878823 3:8645592-8645614 ACTCCTCTGCAGCTGAACCTGGG + Intronic
951392951 3:22129760-22129782 ACTCTCCAGGAGCTAAAGCCTGG + Intronic
951581434 3:24168764-24168786 ACTCAAAGGCAGGTGAAGCCTGG - Intronic
951970638 3:28440985-28441007 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
952587616 3:34911747-34911769 ACTCAACAGTGGCTGTAGCCAGG + Intergenic
953165108 3:40457704-40457726 ACGCCTCAGTAGCTTAAGCCCGG - Intronic
955478190 3:59360767-59360789 ACTGAGCAGGAGCTGAAGCAGGG - Intergenic
956306992 3:67836532-67836554 ACTCAGCAGTAGCTGTAGCCAGG - Intergenic
956703775 3:71982000-71982022 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
957434379 3:80154757-80154779 AATCATCAGCAGCGGTAACCAGG - Intergenic
957754716 3:84470328-84470350 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
958487552 3:94731572-94731594 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
959607105 3:108253210-108253232 ACTCTTCAGGAGCTAAAGCTAGG - Intergenic
960155391 3:114292954-114292976 ACCCAGAAGCATCTGAAGCCTGG - Intronic
961470310 3:127107239-127107261 CCTCATCGGCAGATGAAGCTGGG - Intergenic
962038795 3:131683299-131683321 AATAATCAGCAGTTGTAGCCAGG - Intronic
963762179 3:149295096-149295118 ACTCATCTGCTTCTGGAGCCTGG - Intergenic
965631594 3:170738847-170738869 ACTCACCAGCTGCTGAAGCAGGG - Intronic
966044205 3:175530018-175530040 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
966445814 3:179999461-179999483 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
968064690 3:195752161-195752183 ACTCATCATAAGCAGAGGCCAGG - Intronic
968631537 4:1654632-1654654 ACTCCCCAGCAGCTGAGGCGGGG + Intronic
969257431 4:6011752-6011774 ACTCAGCAGCAGCTGCAGTTGGG - Intergenic
970720896 4:18987469-18987491 GCTCATCTGCTCCTGAAGCCTGG - Intergenic
971095227 4:23393232-23393254 TTTCATCAGCAGCTGTAACCTGG - Intergenic
971100889 4:23465519-23465541 ACTCAGCAGTAGCTGCAGCCAGG + Intergenic
971126559 4:23761209-23761231 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
971214628 4:24651725-24651747 TCTCAGCGACAGCTGAAGCCGGG + Intergenic
971233906 4:24824308-24824330 ACTTATCAGCATCTGATGCAGGG + Intronic
971426517 4:26521232-26521254 ACCCACCAGCAGCTGGAGTCTGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
974478931 4:62419990-62420012 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
975708850 4:77138718-77138740 ACTCATCAGTAACAGTAGCCAGG + Intergenic
976301218 4:83517230-83517252 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
976854812 4:89591029-89591051 AGTCATCAGCAGCTGAAATATGG + Intergenic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
979982154 4:127270428-127270450 AGTCTTCAGCAACTGTAGCCTGG - Intergenic
983185199 4:164692476-164692498 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
984102177 4:175499558-175499580 ACTCATCAGCACCCAAAGTCTGG + Intergenic
984418141 4:179486776-179486798 ACTCAGTAGCAGCTTTAGCCAGG + Intergenic
986087229 5:4463619-4463641 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
986261506 5:6151622-6151644 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
986291906 5:6406803-6406825 TCTCATCAGCAGCTCCTGCCTGG - Intergenic
987504853 5:18754536-18754558 ACTCATCTGCTTCTGGAGCCAGG + Intergenic
987578216 5:19757409-19757431 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
987935006 5:24452060-24452082 CCTCAACATCAGCAGAAGCCAGG + Intergenic
988512461 5:31877066-31877088 ATTTATCAGCAGCTTAAACCAGG - Intronic
989457521 5:41660866-41660888 ACTCAGCAGTAGCTATAGCCAGG + Intergenic
991033680 5:62106825-62106847 ACTCATCAGTGGCTGTAGCCAGG - Intergenic
991142423 5:63260194-63260216 ACTCATCAGGAGCAGAACACAGG - Intergenic
991946273 5:71901027-71901049 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
995776154 5:115726798-115726820 ACTCAGCAGCGGCTGTAGCCAGG + Intergenic
996536774 5:124585703-124585725 CCTCATCAGCTTCTGGAGCCTGG + Intergenic
996827312 5:127699972-127699994 GCTCATCAGCAACTGGATCCTGG - Intergenic
997747506 5:136311917-136311939 ACCCATCGGCTACTGAAGCCTGG + Intronic
997829437 5:137137162-137137184 CCTCATAATCAGCTAAAGCCTGG + Intronic
998290203 5:140907651-140907673 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1002411862 5:179085804-179085826 ACTCATCAGCTGATGAACACTGG - Intergenic
1003038255 6:2663482-2663504 CCTCCTCAGAAGCAGAAGCCTGG + Intergenic
1003489446 6:6608556-6608578 AGTTTTCAGCAGCTTAAGCCTGG + Intronic
1004358417 6:14949810-14949832 CCTCACCAGTAGGTGAAGCCGGG + Intergenic
1005375483 6:25178078-25178100 GCTCATCAGCACATGAAGCCTGG + Intergenic
1006554959 6:34858261-34858283 ACTCAGCAGCAGCAAAACCCCGG - Exonic
1006979395 6:38134742-38134764 ACTCCTCAGCTGCTGGGGCCTGG + Intronic
1009736896 6:67688032-67688054 ACTCATCTTGAGCTGAAGCTAGG - Intergenic
1010126515 6:72438674-72438696 ACTCATTTGCAGATGAAGCTGGG - Intergenic
1010323696 6:74541393-74541415 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1012352851 6:98274887-98274909 ACTCATCAGCAGATGCCCCCAGG - Intergenic
1012730572 6:102875165-102875187 ACTCACCAGTGGCTGGAGCCAGG - Intergenic
1014538721 6:122648860-122648882 ACTCAGCAGTGGCTGAAGTCAGG + Intronic
1015527560 6:134187974-134187996 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1016283340 6:142445108-142445130 TCTCATCATCTGCTGGAGCCAGG - Exonic
1016649034 6:146442455-146442477 CCTCATGGGCAGCTCAAGCCAGG + Intergenic
1016826812 6:148396024-148396046 ACTCATCAGCAGCTGAAGCCTGG + Intronic
1017976907 6:159366245-159366267 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1019131495 6:169880395-169880417 ACTCATCTGCTGCTGAACCATGG + Intergenic
1023018060 7:35985393-35985415 CCTCTGCAGCTGCTGAAGCCAGG - Intergenic
1024084494 7:45882180-45882202 ACTCACCAGCAGCTGAAAATTGG - Intergenic
1026046364 7:66908210-66908232 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1026180830 7:68039094-68039116 ACTCGTCTGTAGCTGCAGCCTGG - Intergenic
1026304112 7:69125062-69125084 AGTGGTCAGCAGCTGAACCCTGG - Intergenic
1027481396 7:78701964-78701986 ATTCATCAGCAGGAGAATCCTGG - Intronic
1028540460 7:91938009-91938031 ACTCTACAGGATCTGAAGCCGGG + Intergenic
1029633439 7:101767910-101767932 ACCCTGCAGCAGCTGAAACCAGG + Intergenic
1030883155 7:114905646-114905668 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1031474333 7:122204460-122204482 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1032187753 7:129741875-129741897 ACCCAACAGCAGCAGCAGCCTGG + Intronic
1035754075 8:2018053-2018075 AATAATCAGCAGCGGTAGCCAGG - Intergenic
1037679320 8:21081015-21081037 ATTCTCCAGCAGCTGAAGCCAGG - Intergenic
1037712167 8:21363455-21363477 GCTACTCAGAAGCTGAAGCCAGG - Intergenic
1037953785 8:23037293-23037315 ACTCAGTAGCAGCTGTAGCCAGG - Intronic
1039194182 8:35012218-35012240 ACTCATTAGCAGCTGACTACTGG - Intergenic
1039479309 8:37860018-37860040 TCCCAGCAGCAGCAGAAGCCAGG + Exonic
1040675096 8:49739777-49739799 AATCAACAGCCGCTGAACCCAGG + Intergenic
1041201478 8:55454532-55454554 GCCCATCAGCAGCTGCAGCGTGG - Intronic
1041434913 8:57828393-57828415 ACTCACTAGCAGCCCAAGCCTGG + Intergenic
1041591966 8:59598183-59598205 ACTCATGAGCTGAAGAAGCCAGG + Intergenic
1041935430 8:63326904-63326926 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1043232520 8:77820933-77820955 ACTCATCTGCAGGTGATGGCAGG + Intergenic
1044178600 8:89160976-89160998 ACACAGGAGCAGCTGAAGCTGGG - Intergenic
1044895942 8:96891417-96891439 ACTCAGCAGTGGCTGTAGCCGGG + Intronic
1046128544 8:109940695-109940717 ACTCAGCAGTAGCTGCAGTCAGG + Intergenic
1047104450 8:121718092-121718114 ACTCATTAGCAGCTGTGGTCTGG + Intergenic
1049203147 8:141351532-141351554 ACTCAGCTGGAGCTGAGGCCAGG - Intergenic
1049483548 8:142839559-142839581 ACGCATCAGCAGCTGGGCCCAGG + Intronic
1050145186 9:2560015-2560037 AATAATCAGCAGCAGTAGCCAGG + Intergenic
1052227709 9:26109274-26109296 ACTCAGCAGTGGCTGTAGCCAGG - Intronic
1052352311 9:27470306-27470328 TCTCTTCTGCAGCTGAAGCAGGG + Intronic
1055642318 9:78329497-78329519 AATCAACAGCCGCTGAACCCAGG - Exonic
1056720267 9:89065187-89065209 ACACACCAGGAGCTGAAGCTGGG + Intronic
1058131676 9:101260608-101260630 ACTCAAGAGAAGCTGCAGCCTGG + Intronic
1059196375 9:112374966-112374988 ACTCAGCAGTGGCTGTAGCCAGG + Intergenic
1060304472 9:122398381-122398403 AATAATCAGCAGCAGTAGCCAGG + Intergenic
1061545348 9:131301286-131301308 ACCCATCAGCTGCTGAGTCCTGG + Intronic
1203781716 EBV:104721-104743 CCTCCGCAGCCGCTGAAGCCAGG + Intergenic
1186538448 X:10373992-10374014 TCTCATCAGGAGATGAAGCCAGG - Intergenic
1186543856 X:10428421-10428443 TATCATCAGCAGCTAAACCCAGG - Intergenic
1186638949 X:11434562-11434584 ACTCCTGAGCCTCTGAAGCCAGG - Intronic
1188302911 X:28527595-28527617 AGACATCAGCAGCTTAACCCTGG - Intergenic
1188651324 X:32634499-32634521 AATAATCAGCAGCTGTAGCCAGG - Intronic
1190527776 X:51345420-51345442 ACTCAGCAGCAGCTGTAGCCAGG + Intergenic
1190797271 X:53757472-53757494 ACACAGCAGCAGCTGGAACCTGG - Intergenic
1190913069 X:54789610-54789632 ACACAGCAGCAGCTGGAACCTGG - Intronic
1191611637 X:63121711-63121733 AATCATAAGCAGCTGCAGCACGG + Intergenic
1192297586 X:69867128-69867150 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1192374857 X:70549246-70549268 AGTGATCAGCAGCAGTAGCCAGG + Intronic
1193170631 X:78331863-78331885 ACTCATCTCCAGCTGAACTCAGG - Intergenic
1193297899 X:79853556-79853578 ACTGAGCAGTAGCTGTAGCCAGG - Intergenic
1195748395 X:108141171-108141193 ACTCAGCAGGGGCTGTAGCCAGG + Intronic
1195748804 X:108144462-108144484 ACTCAGCAGGGGCTGTAGCCAGG + Intronic
1195782225 X:108478975-108478997 ACTCAGCAGAGGCTGTAGCCAGG + Intronic
1197182223 X:123548681-123548703 ACTCAGCAGTGGCTGTAGCCAGG - Intergenic
1197244922 X:124158102-124158124 ACTCAGCAGTGGCTGTAGCCAGG + Intronic
1201529539 Y:14977006-14977028 ACACATCAGCAGCTATAGCCAGG + Intergenic