ID: 1016827032

View in Genome Browser
Species Human (GRCh38)
Location 6:148397973-148397995
Sequence CTGGGTTACCACTTCCTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016827032_1016827045 29 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827045 6:148398025-148398047 TGACCTGGTTGAGGGAGGTGTGG 0: 1
1: 0
2: 0
3: 32
4: 364
1016827032_1016827038 1 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827038 6:148397997-148398019 CTTCCCAATCAGAAGGCACAGGG No data
1016827032_1016827044 24 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827044 6:148398020-148398042 AAGACTGACCTGGTTGAGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 199
1016827032_1016827041 14 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827041 6:148398010-148398032 AGGCACAGGGAAGACTGACCTGG 0: 1
1: 1
2: 0
3: 23
4: 319
1016827032_1016827037 0 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827037 6:148397996-148398018 GCTTCCCAATCAGAAGGCACAGG No data
1016827032_1016827034 -6 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827034 6:148397990-148398012 ACCCAGGCTTCCCAATCAGAAGG No data
1016827032_1016827042 20 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827042 6:148398016-148398038 AGGGAAGACTGACCTGGTTGAGG No data
1016827032_1016827043 21 Left 1016827032 6:148397973-148397995 CCTTAGAGGAAGTGGTAACCCAG 0: 1
1: 0
2: 1
3: 10
4: 137
Right 1016827043 6:148398017-148398039 GGGAAGACTGACCTGGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016827032 Original CRISPR CTGGGTTACCACTTCCTCTA AGG (reversed) Intronic
901568268 1:10137238-10137260 CTGAGTTACCACTTTTTCTCAGG + Intronic
902589022 1:17460327-17460349 CTGTGTCACATCTTCCTCTAAGG + Intergenic
907761684 1:57367814-57367836 CTGGGTTCCTGCTTGCTCTATGG - Intronic
908552312 1:65221837-65221859 CTAGGTTAGCACTTTCACTATGG - Intronic
909037394 1:70609515-70609537 TTGGGTTCCCACTTCTTATAGGG + Intergenic
909146292 1:71937443-71937465 CTGTGTGACCACTGCATCTATGG + Intronic
910104727 1:83619341-83619363 CTCTGTTACCACCTCCTCCAAGG - Intergenic
910899672 1:92106300-92106322 CTGGTATACCACATCCTCTCAGG - Intronic
911665223 1:100543791-100543813 CTGGGTTCCCACATTCTCTAAGG + Intergenic
913444374 1:118934257-118934279 CTGGGTTAGCACTTGCACTGGGG - Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
915996882 1:160572668-160572690 GTGGGTTACCACTTCTTCACTGG - Intronic
917194804 1:172454061-172454083 CTGAGATTCCACTTCCTATAGGG + Intronic
917520617 1:175745470-175745492 CAGAGTTACCAGTTCCTCAAAGG + Intergenic
921397149 1:214680597-214680619 CTTGGTTATCACTTCCTCCTGGG + Intergenic
923443753 1:234048534-234048556 CAGGGCTACCACTTCCACCATGG + Intronic
924129685 1:240893692-240893714 CTGGGTTTCCTTTTCCTCTGTGG - Intronic
1064236456 10:13580654-13580676 CAGGGTTACCACTGCTTCAAGGG - Intergenic
1068289410 10:54983540-54983562 CTGGGTTACTATTTCTTCTCAGG - Intronic
1069833229 10:71293692-71293714 CAGGGTCACCACCTCCTGTAGGG - Exonic
1069840466 10:71336439-71336461 CTGGGGAAACATTTCCTCTAAGG - Intronic
1073043151 10:100621130-100621152 CTCGGTTTCCTCTTCCTCAATGG - Intergenic
1073939992 10:108686005-108686027 CTTAGTTACCTCTTCCTCTGTGG + Intergenic
1074213520 10:111361059-111361081 CTGAATTACCACTTCCTTGAGGG - Intergenic
1076511153 10:131014495-131014517 CTGGGTCACCCCTGCCTCCAGGG + Intergenic
1080640844 11:34157468-34157490 ATGGGTGACCACTGCCTGTAAGG - Intronic
1087582989 11:100082908-100082930 CTGGCATCCCACTTCCTGTATGG - Intronic
1087896114 11:103588469-103588491 CTGGATAAACACTTCCTCTTAGG + Intergenic
1089223077 11:116891589-116891611 GTGGTTTACCATTGCCTCTAAGG - Intronic
1092891774 12:12975604-12975626 CTGAGTCACCACTTCCTAGATGG + Intronic
1094718990 12:33042953-33042975 CTGCTTTAACACATCCTCTAAGG - Intergenic
1104544732 12:129700454-129700476 CTGGGGCACCACTTGCTCGATGG + Exonic
1104640540 12:130464209-130464231 CTGGCTTTCGCCTTCCTCTACGG + Intronic
1107155475 13:37162133-37162155 CTGGGTTACTACTTTTTATAGGG + Intergenic
1107606343 13:42061052-42061074 CTCGGAGACCCCTTCCTCTATGG - Intronic
1112386346 13:98943493-98943515 CTGGATTTCCATTTCCTTTAAGG + Intronic
1113734193 13:112665483-112665505 CTGGGTTACATCTGCCACTAGGG - Intronic
1119333238 14:73811128-73811150 CTGGTTTTCCTCTACCTCTATGG + Intergenic
1121077177 14:91078642-91078664 TAGGGCTACCACATCCTCTAGGG - Intronic
1121639933 14:95478535-95478557 CTGTGTCACCACTCCCTGTAAGG + Intergenic
1124723339 15:32132699-32132721 CTGGCTTCCCTCTTCCTATAAGG + Intronic
1127389801 15:58496336-58496358 GGGATTTACCACTTCCTCTAAGG + Intronic
1133532409 16:6667246-6667268 CTGGGTTACCACTGTGTCCATGG - Intronic
1134509883 16:14837486-14837508 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134697531 16:16235985-16236007 CTGGGTTAACACTTCGTGTCTGG + Intronic
1134974312 16:18558690-18558712 CTGGGTTAACACTTCGTGTCTGG - Intronic
1135482507 16:22832766-22832788 CTGGGATACCCCTTCCACTGTGG - Intronic
1137366738 16:47865990-47866012 CTGAGATGCCACTTCCTCCAAGG - Intergenic
1137606531 16:49790407-49790429 CTGGGTTTCGTCTTCCTCAACGG + Intronic
1139357753 16:66377390-66377412 CTGGGAGTCCACTTCCTCCAGGG + Intronic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1143757787 17:9079555-9079577 CTGGGGAACCACTTCCTCAAGGG - Intronic
1143757791 17:9079572-9079594 CTGGGCTACCACTTCCTCTGGGG - Intronic
1143757815 17:9079650-9079672 CTGGGGAACCACTTCCTCCAAGG - Intronic
1143757839 17:9079730-9079752 CTGGGGAACCACTTCCTCCAGGG - Intronic
1143757862 17:9079810-9079832 TTGGGGAACCACTTCCTCCAGGG - Intronic
1143757934 17:9080055-9080077 CTGGGGAACCACTTCCTCAGGGG - Intronic
1146459294 17:33033162-33033184 CAGGGTTCCCACTGGCTCTACGG - Intronic
1147345227 17:39787862-39787884 CTGGTTTCCCATTTCCTCTCTGG + Intronic
1147998963 17:44376520-44376542 CTGGGAAAGAACTTCCTCTAGGG + Intronic
1155073878 18:22338578-22338600 CTGCTTTACCCTTTCCTCTAAGG - Intergenic
1155191110 18:23431421-23431443 CAGGGTATCCACTTCATCTATGG + Intronic
1155422328 18:25668573-25668595 CTTGTTTACCTCTCCCTCTATGG - Intergenic
1156854230 18:41763648-41763670 CTGAGTTACTACTTCTGCTAGGG - Intergenic
1157394426 18:47330034-47330056 CTGGGGTATCACTTGCTCTCTGG + Intergenic
1157482965 18:48067576-48067598 CAGAGTTACCTCTTCCTCTGGGG - Intronic
1161478447 19:4498836-4498858 CAGGGTTCCCAGCTCCTCTAGGG - Exonic
1162458068 19:10797782-10797804 CTGGGAAACCCCTTTCTCTAGGG - Intronic
1166602694 19:44112004-44112026 CTCGGAGACCCCTTCCTCTATGG - Intergenic
1166812385 19:45522256-45522278 CTGGCTGGCCACTTCCTCCAGGG - Intronic
925066670 2:933157-933179 CTGGGTCAGCACTTTCTCTAGGG - Intergenic
925327329 2:3033518-3033540 CTGGGTTAGGGCGTCCTCTACGG - Intergenic
931133968 2:59376039-59376061 CTGGTTTTCCACATCCTCTTCGG - Intergenic
931538043 2:63300143-63300165 CTAGGAGACCTCTTCCTCTACGG + Intronic
931792379 2:65676031-65676053 CTGGGCTTCCACTTCCAATATGG - Intergenic
935228386 2:101074872-101074894 CTGGGTTGTCATTGCCTCTAAGG - Intronic
936947759 2:117945985-117946007 CTGGGATACCACTGCCTCCTAGG + Intronic
946599835 2:221347713-221347735 CTGGGTACCCACATCCTCCAAGG - Intergenic
947243490 2:228021078-228021100 CTGGGGTACCCCTTCCTCTGTGG + Intronic
948339073 2:237234514-237234536 CTGGGATAGAACTTCCTCCAGGG - Intergenic
1168880832 20:1204748-1204770 CTGGGTCAGCCCTTCCTCTGGGG - Intronic
1169677731 20:8173170-8173192 CTGGGATACCTCTTTCTCCATGG + Intronic
1170714174 20:18817689-18817711 CTGGCTCCCCACTGCCTCTAGGG + Intronic
1172909514 20:38396330-38396352 CTGGGATGCCATTGCCTCTAGGG + Intergenic
1173831750 20:46093576-46093598 GTGGGTTACCCCTTACTGTAAGG + Intergenic
1174763431 20:53229247-53229269 CTGGGTTAGCTGCTCCTCTAGGG - Intronic
1174869017 20:54166288-54166310 CTGGGCTAGCACTTCATATAGGG + Intronic
1176973267 21:15290105-15290127 ATAGGTTACCACTTCCTCTGTGG + Intergenic
1177904619 21:26960500-26960522 CTTGGGTATCACTTCTTCTAAGG - Intronic
1183661352 22:39223325-39223347 CTGAGGATCCACTTCCTCTATGG + Intergenic
951077186 3:18409538-18409560 CAGGTTTACCATTTCCTTTATGG + Intronic
955761337 3:62286711-62286733 TTTGTTTGCCACTTCCTCTAAGG - Intronic
957538241 3:81533613-81533635 CTGGGTGTCCACTTCATCAAGGG + Intronic
959965064 3:112344956-112344978 CTGGGTCACCACTTGCACTATGG - Exonic
960630815 3:119728781-119728803 CTGAGTTAACAGCTCCTCTAAGG + Intronic
960955870 3:123030135-123030157 CTGGCTTACCACCTGCTCTTTGG + Intergenic
961796915 3:129415688-129415710 GTGGGTTTCTTCTTCCTCTAGGG + Intronic
966805445 3:183804150-183804172 CTGGGTCAGCACGTCCTCGATGG - Exonic
972295000 4:37729140-37729162 CAGCCTTACCTCTTCCTCTAAGG + Intergenic
978178466 4:105763873-105763895 ATGGGTTACAACTACCTCTGGGG - Intronic
979297817 4:119053004-119053026 CTGGGTTGTCACTTCCACCATGG - Intronic
979955842 4:126953109-126953131 CTGGGAAACCACTTCCACAATGG - Intergenic
988290506 5:29278226-29278248 CTGGGAGACCAATTTCTCTATGG + Intergenic
993652187 5:90535630-90535652 CTGGGTTATCACTTGCACTCAGG + Intronic
993976674 5:94491410-94491432 CTGGAGTCCCACTTCCTCTCAGG - Intronic
994384492 5:99113599-99113621 TTGCTTTACCACTTCCCCTAAGG - Intergenic
1000268096 5:159657547-159657569 CTGGAGTTCCACTCCCTCTAGGG - Intergenic
1001388143 5:171357010-171357032 ATGGGTTACCACCTCCCCTATGG + Intergenic
1001494759 5:172179802-172179824 TTGGGTTTCCACTTCCTCTGGGG - Intronic
1003134821 6:3426932-3426954 CTGGCTTACCACTGTCTCTGAGG + Intronic
1005382187 6:25246939-25246961 CTGAGTTACTCCTTTCTCTATGG - Intergenic
1006142998 6:31942247-31942269 CTGGCTTACCTCTTCTTATAAGG + Intronic
1006946414 6:37787334-37787356 CTGGCTCTCCACTTCCTCTGAGG + Intergenic
1007366044 6:41393848-41393870 CAGTGTTACCACCTCCTCTGTGG + Intergenic
1007461479 6:42022455-42022477 TTGTATTACCACTTCCTCTGGGG + Intronic
1007597545 6:43060638-43060660 CTGTGTTCCCACTTCCTCAGAGG - Intronic
1012784614 6:103607577-103607599 TTTGGCTACCACATCCTCTAGGG + Intergenic
1013018503 6:106184561-106184583 CTGGTTTTACTCTTCCTCTAGGG + Exonic
1016827032 6:148397973-148397995 CTGGGTTACCACTTCCTCTAAGG - Intronic
1018255156 6:161911223-161911245 CAGAGTGACCACTTCCTCTTTGG - Intronic
1018353402 6:162987222-162987244 TTGTGTTCCCACTTCCCCTAAGG + Intronic
1018873944 6:167803858-167803880 CTGGGTCAGCATTTCCTCTTGGG - Intergenic
1021401351 7:20213016-20213038 CTGGGATACCACTTCCACCTTGG + Intronic
1022127714 7:27374315-27374337 CTGGGTTATTACTTCCACTGTGG + Intergenic
1023315675 7:38933948-38933970 CTGGGTTATTACTTCCTTGAAGG + Intergenic
1024714191 7:52055927-52055949 CTGTTTTCCCACTTCATCTAGGG - Intergenic
1028069133 7:86428528-86428550 CAGGGTTTTCATTTCCTCTAAGG + Intergenic
1029973882 7:104814997-104815019 CTGGGCTCCCACCTGCTCTATGG + Intronic
1030183135 7:106731707-106731729 CTGGTTACCGACTTCCTCTAAGG + Intergenic
1037895931 8:22655227-22655249 CTGGGTTTCCACTTTCTTAATGG + Intronic
1039266625 8:35831591-35831613 CTGCACTGCCACTTCCTCTATGG + Intergenic
1042917754 8:73892120-73892142 CTGGTTTACCACTTTCTATTTGG - Intergenic
1043858882 8:85292645-85292667 CTAGGTTCCCTCTTCCTTTATGG + Intergenic
1044340547 8:91041344-91041366 TGGGGTTATCAATTCCTCTAGGG + Intergenic
1046247628 8:111585889-111585911 CTGGGTTAGAACTTCCCCCAAGG - Intergenic
1046956517 8:120067997-120068019 CTTGGTCTCCACTTCCTCTGTGG - Intronic
1047759344 8:127942525-127942547 ATGGGTTATCATTTCCCCTATGG - Intergenic
1049076092 8:140397207-140397229 CTGGGTTACCACTGTGTCAAAGG + Intronic
1049421669 8:142519325-142519347 CTGGGTCCCCACTTCCTCATGGG - Intronic
1053131829 9:35619599-35619621 CTCAGTGGCCACTTCCTCTAGGG - Intronic
1060428627 9:123527564-123527586 CTTGGGTATCACTTCCTCCAGGG + Intronic
1186069828 X:5807319-5807341 ATGTGTAACCACATCCTCTAAGG + Intergenic
1186451755 X:9679855-9679877 CTGCTTGACCACTTCCTCTTAGG - Intronic
1187477745 X:19626868-19626890 CTGGGTCCCCTCTTTCTCTAGGG + Intronic
1192923950 X:75736239-75736261 CTGGGTTACTACCTCCTTTTTGG + Intergenic
1194444020 X:93965660-93965682 CTGTGTTACCCCCTCCACTAGGG + Intergenic
1200254541 X:154573070-154573092 TTGGATTCCCACTTCCTCTCAGG - Intergenic
1200263228 X:154631338-154631360 TTGGATTCCCACTTCCTCTCAGG + Intergenic
1201524892 Y:14921356-14921378 ATGTGTAACCACGTCCTCTAAGG - Intergenic