ID: 1016830016

View in Genome Browser
Species Human (GRCh38)
Location 6:148424762-148424784
Sequence TCAGTGGCCTGCAGGTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016830016_1016830021 13 Left 1016830016 6:148424762-148424784 CCCCTTCACCTGCAGGCCACTGA 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1016830021 6:148424798-148424820 CAGCTCTGAGCAGCCTTCTTTGG 0: 1
1: 0
2: 1
3: 32
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016830016 Original CRISPR TCAGTGGCCTGCAGGTGAAG GGG (reversed) Intronic
900788187 1:4662913-4662935 TCAGATGCCTGGAGGTGGAGGGG + Intronic
900948733 1:5845698-5845720 TCTGTGGCCAGCAGGGGCAGTGG + Intergenic
901002312 1:6154891-6154913 TGAGTGGCCTGTAGGGGGAGAGG + Exonic
902203622 1:14851861-14851883 CCAGTGACCTGCAGTTGCAGGGG - Intronic
903269521 1:22178653-22178675 TCAGAGGACAGCAGGCGAAGAGG - Intergenic
903698877 1:25231537-25231559 TAAGTGCCCTGGAGGTGCAGAGG - Intronic
905251538 1:36651958-36651980 TTAGTGGTCTGCAGGTGAGCTGG - Intergenic
907560687 1:55384840-55384862 CCTGTGGCCTGCATCTGAAGGGG + Intergenic
908090463 1:60680085-60680107 TTAGTTGCCTGGAGATGAAGAGG + Intergenic
911539843 1:99145402-99145424 ACAGTGGCATATAGGTGAAGGGG - Intergenic
912595935 1:110875677-110875699 TCAGTGCCCTGCACCTGCAGTGG - Intronic
912915593 1:113811884-113811906 TCAGAGGCGAGAAGGTGAAGAGG + Exonic
915647246 1:157281691-157281713 GCAGGGCCTTGCAGGTGAAGTGG + Intergenic
916720808 1:167483695-167483717 GCACTGCCCTGCAGGTGATGTGG - Intronic
921052322 1:211519706-211519728 TCAGTGCCCTGCATGTTGAGAGG - Intergenic
922795307 1:228336821-228336843 TCAGTGGCCGGCAGGGCAGGAGG - Intronic
923038325 1:230301079-230301101 TCAGCAGCCTGGTGGTGAAGGGG - Intergenic
923386055 1:233466104-233466126 TCAGTGGCCCGCAGTCGGAGCGG + Intergenic
923676121 1:236082021-236082043 TCACTGCCCTGCAGGCGAGGGGG + Intergenic
924212082 1:241780211-241780233 GCAGTGGTCTGCTGGTGAAAAGG + Intronic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1067063639 10:43090928-43090950 TGAGTGGACAGCAGCTGAAGTGG + Intronic
1068122855 10:52801612-52801634 ACAGTGGCCTGGGGGTGAGGTGG + Intergenic
1069831399 10:71284396-71284418 TCAGTGGCCTGCAGGCGGGTAGG - Intronic
1073458187 10:103650288-103650310 TCTGTGGGCTGCTGGTGCAGTGG - Intronic
1075075738 10:119349142-119349164 CCAGTGACCTGCTGGAGAAGAGG + Intronic
1075567502 10:123515277-123515299 GCAGTGGCCTGGAGGTCAGGAGG + Intergenic
1076182253 10:128419316-128419338 TCTGTGGTCTGTAGGTGAAATGG + Intergenic
1076686268 10:132199783-132199805 TCTGAGGCGTGCAGGTGAATGGG + Intronic
1077044823 11:540156-540178 GCAGCTGCCTGCAGGTGAAGGGG + Intronic
1077228134 11:1447220-1447242 TCAGTGGCCTGCATGTCATGGGG + Intronic
1077530485 11:3092591-3092613 GCAGTGGCCCTCAGGTGAGGGGG + Intronic
1081690296 11:45073557-45073579 TTTGTGGCCTGGTGGTGAAGAGG - Intergenic
1083623030 11:64058377-64058399 ACAGTCACCTGCAGGTGAGGAGG + Intronic
1084271332 11:68030864-68030886 TCCGTGTCCTTCAGGTGCAGCGG + Intronic
1084954204 11:72682940-72682962 TGAGGGCACTGCAGGTGAAGGGG - Intergenic
1087442767 11:98207558-98207580 TCACTGCCCTGAAGGTGATGAGG - Intergenic
1088367824 11:109057658-109057680 TCAGTGGCCTCCTGGAGAAGAGG + Intergenic
1089290775 11:117436972-117436994 ATGCTGGCCTGCAGGTGAAGGGG - Intronic
1089381581 11:118036616-118036638 TCACTGCCCTGCAGCTGGAGGGG - Intergenic
1090916427 11:131167992-131168014 CAAGGGGCCAGCAGGTGAAGTGG - Intergenic
1091139368 11:133222187-133222209 TCAGGGGCCTGCAGATGACCAGG + Intronic
1093797501 12:23330481-23330503 TCAGTGTTCAGCAGGTGAAATGG + Intergenic
1094475867 12:30840098-30840120 ACACTGGTCTGCAGGTGGAGGGG + Intergenic
1098092646 12:66920610-66920632 TCAGTGACCTGGTGGGGAAGAGG - Intergenic
1099996389 12:89783971-89783993 TCATTGGCCAGCTGGTAAAGAGG + Intergenic
1102789551 12:115633426-115633448 TCAGTTTCCTGCAGGCAAAGTGG + Intergenic
1104918477 12:132278511-132278533 TCACTGGCCCGCAGGTGTTGGGG - Intronic
1104932076 12:132345173-132345195 CCAGTGGACTGGAGGTGGAGAGG + Intergenic
1104968725 12:132521546-132521568 TCCCAGGCCTGCAGGTGCAGAGG + Intronic
1106835857 13:33634799-33634821 TCACTGGCCTCCAGGGAAAGTGG + Intergenic
1110566708 13:76964779-76964801 TGTGTGGCCTGCCAGTGAAGAGG - Intergenic
1111210954 13:85079442-85079464 TCATTCCCCTGCAGGTGAATAGG + Intergenic
1111396956 13:87677002-87677024 TCACTGGCAAGGAGGTGAAGTGG - Exonic
1113384503 13:109836152-109836174 TCAGTAAGCGGCAGGTGAAGGGG + Intergenic
1113650181 13:112028844-112028866 TCAGGGACCTGCAGGTTCAGTGG + Intergenic
1113890194 13:113731543-113731565 CCTGAGGCCTGCAGGTGGAGGGG + Intronic
1114002939 14:18280909-18280931 TCAGAGGCCTGCAGTACAAGTGG + Intergenic
1115892739 14:38050012-38050034 ACAGTGACCTGCAGTTGAAGAGG - Intergenic
1116060193 14:39913925-39913947 CCGGGGGCCTGCAGCTGAAGGGG - Intergenic
1118229972 14:63938676-63938698 TGAGAGGGCTGCAGGGGAAGTGG + Intronic
1118904001 14:70010368-70010390 TCTGTGGACTGCAGGAGAGGTGG - Intronic
1119655631 14:76414807-76414829 CCCGTGGCCTGGAGGTGCAGTGG + Intronic
1119706243 14:76784354-76784376 TCAGAGGCCTGACGATGAAGGGG + Intergenic
1122537928 14:102479222-102479244 TCAGTGACCAGCAGGTAAAGAGG + Intronic
1123091097 14:105742638-105742660 GCAGAGGCCTCCGGGTGAAGAGG + Intergenic
1123473268 15:20570229-20570251 TCTGTGGCCTACAGTTGAAATGG + Intergenic
1123644740 15:22430124-22430146 TCTGTGGCCTACAGTTGAAATGG - Intergenic
1123733568 15:23165240-23165262 TCTGTGGCCTACAGTTGAAATGG + Intergenic
1123751700 15:23362615-23362637 TCTGTGGCCTACAGTTGAAATGG + Intronic
1124284072 15:28386539-28386561 TCTGTGGCCTACAGTTGAAATGG + Intronic
1124298625 15:28525075-28525097 TCTGTGGCCTACAGTTGAAATGG - Intronic
1124875646 15:33590317-33590339 TCAGAGGCCTGAAGGTAATGTGG + Intronic
1125874755 15:43133969-43133991 TCTGGGGCCTGCAGGTGACGCGG + Exonic
1130948568 15:88567807-88567829 CCTGTGGCCTGCAGGTGAAAGGG - Intergenic
1131021424 15:89102507-89102529 GCAGTGGCTTGCAAATGAAGAGG - Intronic
1131282625 15:91033517-91033539 TCTGTGGCCTGCAGTTTAAATGG - Intergenic
1131499994 15:92952930-92952952 CCAGTGGCCTGCAGTGGAATGGG + Intronic
1134378850 16:13705062-13705084 TCAATAGCTTGCAAGTGAAGAGG + Intergenic
1136297039 16:29309546-29309568 ACAGTGGCCTGCAAGCGAACAGG - Intergenic
1138317823 16:56085621-56085643 TCAGTTGCTTCCAGGTAAAGAGG + Intergenic
1139068175 16:63345497-63345519 TTACTGACATGCAGGTGAAGGGG + Intergenic
1141665488 16:85463249-85463271 TGCGTGGCCTGAAGGTGATGGGG - Intergenic
1142058589 16:88015650-88015672 ACAGTGGCCTGCAAGCGAACAGG - Intronic
1142280494 16:89145351-89145373 TCAGCGCCCTGGAGGTGGAGTGG + Exonic
1142895661 17:2976535-2976557 TGTGTGGGCTGCAGTTGAAGTGG + Intronic
1142921295 17:3189421-3189443 AAAGTGGCAGGCAGGTGAAGTGG + Intergenic
1147877795 17:43633781-43633803 CCAGTGGCCTGCAGAAGTAGTGG - Intergenic
1150290995 17:63982108-63982130 TCAGAGGACTGGAGGTGAAGAGG - Intergenic
1151007305 17:70452593-70452615 TCAGTGGTTTCCAGGGGAAGTGG + Intergenic
1151255123 17:72870846-72870868 TCAGAGATCTGCAGGTGGAGAGG + Intronic
1151984207 17:77531615-77531637 TCAGTGGCCTCCAGGGGACTTGG + Intergenic
1151984328 17:77532333-77532355 TCAGTGGCCTCCAGGGGACTTGG - Intergenic
1154315592 18:13301030-13301052 TGTGTGCCCTGCAGCTGAAGGGG + Intronic
1155798750 18:30073812-30073834 TCAGTTTCCTGAAGCTGAAGGGG - Intergenic
1158410162 18:57198533-57198555 GCAGAGGCCTGAAGGCGAAGAGG - Intergenic
1160010748 18:75105717-75105739 TCAGGGGCCTGCAGGGGAACTGG - Intergenic
1161044413 19:2127408-2127430 TCACGGGCCTGCAGTTGCAGAGG - Intronic
1161357814 19:3828833-3828855 CCGGTGGCCTGCAGGTGACGGGG - Intronic
1161405559 19:4089485-4089507 GCAGTGGGCTGCAGATGAAACGG - Intergenic
1161436645 19:4267609-4267631 TTTGGGGCCTGCAGGTGATGGGG - Exonic
1162088236 19:8261342-8261364 GCAGTCGCCTGCTGATGAAGGGG + Intronic
1162783558 19:13020299-13020321 CCAGTGGCATGCAGGAGGAGGGG + Intronic
1164156530 19:22600851-22600873 TCTGTGGCCTACAGTTTAAGTGG + Intergenic
1164697382 19:30255987-30256009 CCAGTGGTCTGCAGATGCAGAGG - Intronic
1165420335 19:35719053-35719075 ACAGGGGCCCGCAAGTGAAGGGG - Intronic
1166775900 19:45312189-45312211 ACTGTGGCCTGCAGGTGGATTGG - Intronic
1167305080 19:48703501-48703523 TGCGGGGCCTGCAGGTGAACGGG + Exonic
1167598065 19:50437697-50437719 TCAGTGGCCTGTTGAAGAAGAGG + Exonic
1167748963 19:51368563-51368585 TCAGTGGCATGGGGGTGAAGCGG - Exonic
925883023 2:8368677-8368699 GAAGAGTCCTGCAGGTGAAGGGG + Intergenic
926012221 2:9417330-9417352 GCAGGGGCCTACAGGAGAAGTGG - Intronic
927757582 2:25721648-25721670 TCAGTGACCTGGAGATGATGTGG - Intergenic
927835081 2:26389822-26389844 TCAGGAACCTGCAGCTGAAGGGG - Exonic
929944955 2:46363211-46363233 TCACTGGCTTTGAGGTGAAGTGG + Intronic
931824030 2:65980822-65980844 TCAGTGGCCTGCATCTCAAATGG - Intergenic
932292593 2:70595009-70595031 TGAGTGGCCTTTAGGTTAAGGGG + Intergenic
932476623 2:72010669-72010691 TCTGTCTCCTGCAGGTGTAGAGG + Intergenic
933858820 2:86443675-86443697 TCACTGGCCTGATGGTTAAGAGG - Intronic
934749447 2:96783402-96783424 TCCGTGGCCAGGAGGTGCAGGGG - Intronic
934754085 2:96813291-96813313 ACAGTGGTCTGAAGGTCAAGTGG + Intergenic
935708833 2:105879755-105879777 TGAGTGGGCAGGAGGTGAAGAGG - Intronic
936513142 2:113164663-113164685 CCAGGGGCCTGCAGGGGAGGAGG + Intronic
936520034 2:113206060-113206082 TCTGTGGCAGGCAGGAGAAGAGG - Intronic
936902149 2:117493544-117493566 TCAGTGGCCAGCAAGTAAACAGG + Intergenic
937315518 2:120929822-120929844 TCAGCCACCTGCAGGTGGAGGGG - Intronic
937856028 2:126672544-126672566 TCTGTGGACTGCAGGTGCTGAGG - Intronic
937871479 2:126789278-126789300 TCAGTGGCCTACAGGAGAGAGGG - Intergenic
940136113 2:150437304-150437326 TCAGTGGCATAAAGGTGGAGTGG + Intergenic
941278186 2:163517134-163517156 ACAGTAGCCTGGAGGTGAGGAGG + Intergenic
942821016 2:180115296-180115318 TCAGAGGCCTCCATGTCAAGAGG + Intergenic
945999117 2:216465955-216465977 GCAGTGCCCAGGAGGTGAAGGGG - Intronic
946390105 2:219409896-219409918 TGAGTGACCTGCAGTTGACGAGG + Intergenic
946760972 2:222992775-222992797 TGAGTGGCATGTAGGTGAACGGG + Intergenic
948711163 2:239826581-239826603 GCAGTGGGCTGCGGATGAAGCGG + Intergenic
948998684 2:241598709-241598731 TGAGTGGCCAGCAGGTGAGTGGG - Intronic
1169781916 20:9318936-9318958 TCTGTGGGCCGCAGGTGAACAGG + Intronic
1170298969 20:14860797-14860819 GCTGTGGCTTGCAGGTTAAGAGG - Intronic
1170780681 20:19422872-19422894 TCAGAGGCCTGCAGGCAAAAGGG - Intronic
1171175538 20:23048970-23048992 CCAGTGGCCTGCAGGTGGCTGGG + Exonic
1171238064 20:23544133-23544155 TGGGTGGCGGGCAGGTGAAGTGG + Intergenic
1171744603 20:28956381-28956403 TTTGTGGCCTGCAGTTGAAAAGG + Intergenic
1172097016 20:32465452-32465474 TCAGTGGCCAGTAGGTGTTGGGG - Intronic
1172534647 20:35664176-35664198 TTCGTGGCCTGAAGGTGGAGGGG - Intronic
1172802006 20:37582333-37582355 TCAGAGGCCTGCAGGTTCAAGGG + Intergenic
1172867426 20:38111010-38111032 CCATTGGCCTGAGGGTGAAGGGG + Intronic
1173621155 20:44436954-44436976 TCAGTGACCTGAAGTTTAAGGGG - Intergenic
1174549518 20:51351864-51351886 GCTGGGGCCTGCAGCTGAAGAGG + Intergenic
1174551748 20:51367265-51367287 CCAGTAGCCTGCAGGGGAAATGG - Intergenic
1175383008 20:58576633-58576655 CCAGGGGGCTGCAGGGGAAGGGG + Intergenic
1176119984 20:63450057-63450079 TGAGGGGCCTGCAGGGGCAGAGG - Intronic
1176382022 21:6118389-6118411 TCAGTGGTTTGGAGGTGAGGGGG + Exonic
1177644777 21:23887317-23887339 TCAGTGGCCTGCTGGTGTCCGGG - Intergenic
1178548488 21:33514603-33514625 ACAGTGGCCTGCTGATGAATGGG - Intronic
1179741450 21:43419850-43419872 TCAGTGGTTTGGAGGTGAGGGGG - Exonic
1179793851 21:43771030-43771052 TCAGGGGTCTGGAGGGGAAGTGG + Intergenic
1180427455 22:15211704-15211726 TCAGAGGCCTGCAGTACAAGTGG + Intergenic
1181432118 22:22888035-22888057 TCATTGGCCTTCAGGTTCAGGGG - Exonic
1182395694 22:30034223-30034245 TCACTGGCCTGAATGTGCAGTGG - Intergenic
1182894533 22:33848443-33848465 TCAGTGGCCTGCAGGGGTGCAGG - Intronic
1184021757 22:41826013-41826035 TCAGGGGCCTCCTGCTGAAGGGG + Exonic
1184143361 22:42592985-42593007 CCAGTCTCCTGCAGGTGCAGAGG - Intronic
1184149632 22:42630722-42630744 TCAGGGGCTTGCAGGGGCAGTGG - Intronic
1185182474 22:49371442-49371464 TCACTGGCCTGGAGGTGACAAGG - Intergenic
1185298046 22:50063874-50063896 TGAGTGGCCTGCAGGGGGAGGGG - Intronic
1185298099 22:50064010-50064032 TGAGTGGCCTGCAGGGGGAGGGG - Intronic
949901607 3:8819540-8819562 TCAGGGGTCTTCAAGTGAAGAGG + Intronic
950032016 3:9859745-9859767 TGGGTGGCCTGCAGGGGACGTGG + Intergenic
950900572 3:16493657-16493679 GCAGGGGCCTGCAGGGGATGGGG - Intronic
953405128 3:42656174-42656196 TCACTGACCTGCAGGTGCAGTGG + Intronic
953538959 3:43797744-43797766 TCAGCTGCCTGCAGGAGAATTGG - Intergenic
954156787 3:48689529-48689551 TGTGTGGCATGCAGGTGAGGGGG - Exonic
955640697 3:61080861-61080883 TCAGTGGCATGCATGTGAATTGG - Intronic
956692067 3:71887812-71887834 ACAGTAGCCAGCAGGGGAAGTGG - Intergenic
961648531 3:128405738-128405760 TCAGGTGCCAGCAGGTGCAGTGG + Intronic
961784767 3:129341182-129341204 TGGGTGGCCTGCAGGGGACGTGG + Intergenic
964725967 3:159814718-159814740 TCATAGGACTGCAGCTGAAGAGG - Intronic
966784967 3:183615190-183615212 TCATTGGGCTGCTGCTGAAGAGG - Intergenic
967046836 3:185745285-185745307 TACCTGGCCTGCAGATGAAGGGG + Intronic
969066605 4:4487264-4487286 TCTGGGGCCTGCAGGTGGTGGGG + Intronic
969265935 4:6064059-6064081 CCAGGGGCCTGCATGGGAAGAGG + Intronic
973816733 4:54626242-54626264 TCAGGGACCTGCGGGTGAGGTGG + Intergenic
976607756 4:86998232-86998254 TCATTGGCCTGCTGTGGAAGGGG + Intronic
982137259 4:152283430-152283452 ACTGGGGCCTGCAGGTGCAGGGG - Intergenic
984623575 4:181980057-181980079 TCTGGGGCCTGCAGGCAAAGTGG - Intergenic
984713715 4:182906579-182906601 TCAGTTGTCTGCTGGTGATGGGG - Intronic
986677387 5:10198173-10198195 TCATTGGCTTGCAGGACAAGTGG - Intergenic
987308962 5:16664564-16664586 TCAGTGGTCTGCAAGAGAAGTGG + Intronic
988449456 5:31326365-31326387 TAAGTGGCCAGGAAGTGAAGGGG - Exonic
990743312 5:58934313-58934335 TGCGTGGGCTGCATGTGAAGAGG + Intergenic
991321625 5:65380140-65380162 TCAGTGGTATGCTGGTGAAATGG - Intronic
991447644 5:66717204-66717226 TCTGTGGCTTGGAGGTGGAGAGG + Intronic
992495412 5:77288332-77288354 TCAGTGGCCTTCAGGGGATATGG + Intronic
994157792 5:96523026-96523048 GCAGTTGCCTGCTGCTGAAGAGG + Intergenic
997283082 5:132660623-132660645 TCAGTTGCCTGTGTGTGAAGTGG - Exonic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999687645 5:154117118-154117140 TCCTGGGCCGGCAGGTGAAGAGG - Intronic
1003102247 6:3185702-3185724 TAAATGGTCAGCAGGTGAAGAGG + Intergenic
1003848985 6:10202694-10202716 TCACTGGACTGTAGGTAAAGTGG + Intronic
1003949926 6:11107851-11107873 TCTTTGGCCTCCAGCTGAAGAGG + Intronic
1007307557 6:40918809-40918831 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1009284388 6:61797549-61797571 TCAGAGGCCAGCAGTAGAAGGGG - Intronic
1009513340 6:64581245-64581267 TAAGTGGTCAGCATGTGAAGAGG + Intronic
1009735351 6:67669973-67669995 TCAATGGCCTGAAGGTGAGAAGG + Intergenic
1009883375 6:69596776-69596798 TTACTGGCTTGCAGGTGGAGGGG - Intergenic
1009940055 6:70280856-70280878 TCAGGGTCCTGCAGGTGAACCGG - Exonic
1015735434 6:136394304-136394326 TCAGTCACCTGCAGGTGGAAAGG - Intronic
1016829155 6:148416599-148416621 TCAGAGGCCTGCAGGAAGAGGGG + Intronic
1016830016 6:148424762-148424784 TCAGTGGCCTGCAGGTGAAGGGG - Intronic
1018790147 6:167142036-167142058 TTAGTGGGCTACAGGAGAAGAGG - Intergenic
1018930874 6:168239540-168239562 TCAGCGGCCTGCAGGCCGAGGGG + Intergenic
1018975729 6:168563902-168563924 TCAGGGGCCTGCAGGGGGCGGGG + Intronic
1019337227 7:491187-491209 TCTGTGGCCCGCAGGGGATGGGG + Intergenic
1019463698 7:1174976-1174998 TCAGGGGCCTGGAAGTGAGGTGG - Intergenic
1019887405 7:3917519-3917541 TCAGGGGCCAGCAGGTAAAACGG + Intronic
1021392131 7:20105737-20105759 TCAGAGGCCTGGAGGAGAACAGG - Intergenic
1022209145 7:28191547-28191569 ATGGTGGCATGCAGGTGAAGGGG - Intergenic
1022359711 7:29646307-29646329 TAAGGGGACTGCAAGTGAAGAGG + Intergenic
1023566313 7:41526888-41526910 AGAGTGTCCTGCAGGTGGAGTGG + Intergenic
1024338447 7:48233241-48233263 TTAGTGGCTGGCAGGTGAAGGGG + Intronic
1025920403 7:65906727-65906749 TCAGTGGCGTGAAAGTAAAGGGG + Intronic
1028512955 7:91645051-91645073 TCAGGGGCCAGCTGGTCAAGAGG + Intergenic
1031219420 7:118945818-118945840 TCAGTGGCCTGCTGGTGTGCCGG - Intergenic
1033491641 7:141849459-141849481 TTAGCGGTATGCAGGTGAAGGGG + Intergenic
1033556212 7:142490299-142490321 TCAGTGGCCAGCAGATACAGAGG - Intergenic
1034244780 7:149636019-149636041 GCATTTGCCTGCAGGTCAAGAGG - Intergenic
1034503374 7:151466527-151466549 GCAGTGGCCTGCAGATGTTGGGG - Exonic
1035127087 7:156616571-156616593 GCAGAGGCCTGCAGCTGTAGCGG - Intergenic
1035353511 7:158263663-158263685 TCTGTGGCCTGCTGGCTAAGGGG + Intronic
1036908011 8:12724133-12724155 TCTGTGGAATGCAGATGAAGAGG - Intronic
1043382943 8:79722548-79722570 ACAGTTGCCTGCAGGGGATGGGG - Intergenic
1047999937 8:130370383-130370405 TCAGCAGCCTGCAAGGGAAGAGG + Intronic
1052758988 9:32570253-32570275 TCAGTGGGTTGCAGGGGAGGAGG - Intronic
1055022641 9:71686526-71686548 TCCATGGACTGGAGGTGAAGGGG - Intronic
1057294880 9:93829017-93829039 TCAGAGGCCTGCAGAGGAACAGG - Intergenic
1058140983 9:101356760-101356782 TCAGTGGCCTGGAGGTGCAGGGG + Intergenic
1058481290 9:105398030-105398052 TCAGTGCCCTGCACGTGAATTGG + Intronic
1058643261 9:107107473-107107495 TCAGTCTTCTGCAGGTGATGTGG - Intergenic
1058900583 9:109438944-109438966 TTAGGGACCTGCAGGTGCAGAGG + Intronic
1060529823 9:124341624-124341646 GAAGGGGCCTGCAGGTGAAAGGG + Intronic
1060536139 9:124389637-124389659 GGAGTGCCCTGCAGGTGAAAGGG - Intronic
1060989332 9:127839166-127839188 TCAGGGGGCCGCAGGTGATGGGG - Intronic
1061140547 9:128763603-128763625 CCAGTGTCTTGCAGGAGAAGGGG + Intronic
1061647829 9:132020268-132020290 TCAGTGATCTACAGGGGAAGTGG - Intronic
1062117568 9:134817667-134817689 TGTGTGGCCTGCAGGGGCAGAGG - Intronic
1185825711 X:3247267-3247289 TCAGTGGAAAGCAGGTGAAGGGG + Intergenic
1186205961 X:7200827-7200849 TGTGTGGCTTGCAGGTGAACAGG - Intergenic
1189251208 X:39601745-39601767 TCAGTGACCAGCAGCTGAAAGGG - Intergenic
1190573683 X:51811533-51811555 TATGTGGCCAGGAGGTGAAGGGG + Intronic
1190776343 X:53555169-53555191 TCTGTGCCCTGCAGGTGGAAGGG + Intronic
1190931401 X:54951838-54951860 TAGGTGGGCTGCAGGTGTAGTGG - Intronic
1195756547 X:108204524-108204546 TCATTGGCATGAGGGTGAAGAGG - Intronic
1200421124 Y:2969236-2969258 ACAGTTGCTTGCAGGAGAAGTGG + Intronic
1201944862 Y:19500993-19501015 GAAGTGGCCTGCTGGAGAAGCGG - Intergenic