ID: 1016832083

View in Genome Browser
Species Human (GRCh38)
Location 6:148444214-148444236
Sequence CCAGATACCTCCCTTAGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016832083 Original CRISPR CCAGATACCTCCCTTAGAAT AGG (reversed) Intronic
902725258 1:18331375-18331397 TGAGTTACTTCCCTTAGAATAGG + Intronic
903970544 1:27116016-27116038 CCAGATTCCTACCTGAGAGTAGG - Intronic
909916454 1:81325251-81325273 CCAGAAACCTGCCTTAGAAGAGG + Intronic
911065814 1:93786948-93786970 GCAGCTAACTGCCTTAGAATGGG + Intronic
911543965 1:99193415-99193437 CAAGATACCTCAATTAGAAAAGG + Intergenic
917094653 1:171388023-171388045 CCAGATACCTGACCTGGAATTGG - Intergenic
919192943 1:194246969-194246991 CCAGATAGCTCCCTTAGCAAAGG + Intergenic
921259274 1:213371173-213371195 CTAGGTACCTCCCGTAGAGTAGG + Intergenic
922667109 1:227480132-227480154 CCAGATACATACATTTGAATTGG - Intergenic
924506922 1:244694921-244694943 CAAGATAGGTCCCTTCGAATTGG + Intronic
1064718338 10:18201243-18201265 TCACATACCTGCCTTATAATAGG + Intronic
1065485329 10:26231331-26231353 ACACATACCTCACTTAAAATAGG - Intronic
1067161495 10:43828703-43828725 CCAGATCCCTCCCTTTAAAGAGG - Intergenic
1071197520 10:83178210-83178232 CCAGGTCCCTCCCTCAGCATTGG + Intergenic
1074857100 10:117481517-117481539 TCAGATTCCTCCTCTAGAATGGG - Intergenic
1077937705 11:6806492-6806514 TCAAATACCTCCCTTAAAATTGG - Intergenic
1080722096 11:34859783-34859805 CCAGATACTTCACTAAAAATAGG - Intronic
1083492126 11:63020946-63020968 CCAGACACCTGCCTAAGAACTGG + Intergenic
1085406926 11:76268902-76268924 CCTGACAGCTCCCTGAGAATAGG - Intergenic
1089050566 11:115541752-115541774 CCAGAAATCTTCCTTGGAATTGG + Intergenic
1089654190 11:119935144-119935166 CCAGGTCCCTCCCTGAGGATAGG - Intergenic
1092008445 12:5088667-5088689 CCAGATTCCACCCTTGGAAGTGG + Intergenic
1093062651 12:14623663-14623685 CCAGGTCCCTCCCTTAACATTGG - Intronic
1098176615 12:67798736-67798758 CCAAACACCTTACTTAGAATGGG - Intergenic
1098405531 12:70122489-70122511 TCAGATATCCCCCTTGGAATAGG + Intergenic
1099746900 12:86716733-86716755 ACAGATACATGCCTTATAATAGG + Intronic
1101836844 12:108301878-108301900 CCAGATCCCACCATTATAATGGG + Intronic
1101866758 12:108526087-108526109 CCATAAACCTACCTTAAAATCGG + Exonic
1102631145 12:114281083-114281105 CTAGATAATTTCCTTAGAATGGG - Intergenic
1102807715 12:115796493-115796515 CCAGAGACCTGCCTGTGAATGGG + Intergenic
1103479448 12:121241602-121241624 CCAGTGACCTCCCTAAGAACAGG - Intronic
1105461745 13:20596857-20596879 CCAGAAACTTCCCTTGGAAAGGG - Intronic
1105953717 13:25259239-25259261 CCTGATACATCTCTGAGAATTGG + Intronic
1109162109 13:58988491-58988513 CCAGATACCTCCCCTAAGACTGG - Intergenic
1110323894 13:74191764-74191786 CCAAATACCTCCCCCTGAATTGG - Intergenic
1110486406 13:76050122-76050144 TCAGTAACCTCCTTTAGAATGGG - Intergenic
1112910271 13:104474173-104474195 CCACATACTTTCATTAGAATTGG + Intergenic
1114422305 14:22594649-22594671 CCAGAGGCCTGCCTTAGAGTAGG + Intergenic
1115008274 14:28512128-28512150 CCAGGTACCTCAGTTGGAATTGG + Intergenic
1121500149 14:94429123-94429145 CATGATACTTCCCTTAGAGTGGG + Intergenic
1123396284 15:19940772-19940794 CCAGATACACCCCTTTGAAATGG - Intergenic
1124821610 15:33051793-33051815 CCGGATTCCTCCCTTGGAGTGGG - Intronic
1124899501 15:33809207-33809229 CCAGATGCCTCCCCTGGAAGTGG - Intronic
1129673674 15:77620987-77621009 CCAGACACCTTCTTTAGAAAAGG + Intronic
1132000274 15:98172471-98172493 CCAGAGACCTCCCTGAGATGAGG - Intergenic
1132145708 15:99428207-99428229 CCAGATCCCTCCGATGGAATGGG + Intergenic
1135342170 16:21658436-21658458 CCAGTCACCTCCCATATAATTGG + Intergenic
1136476137 16:30514722-30514744 CTAAATACCTAACTTAGAATAGG - Intronic
1149371227 17:55995154-55995176 CCAGATACCTCCCAGAGACTAGG - Intergenic
1150041019 17:61861629-61861651 CCAGATTTCTCCCTTAGTTTTGG - Intronic
1151863173 17:76781444-76781466 CCAATTCCCTCCCTGAGAATAGG - Intronic
1153317596 18:3740329-3740351 CCAGCTATTTCCCTGAGAATTGG + Intronic
1157348217 18:46859884-46859906 CCAGATTGATCCCTTAAAATGGG + Intronic
925465762 2:4106289-4106311 CCAGAGGCCTTCCTGAGAATGGG - Intergenic
927184892 2:20475035-20475057 CCAGATACAACCCTGAGAACTGG - Intergenic
927835775 2:26397716-26397738 CCACATACCTTCCTTAGCAAGGG + Intergenic
929609300 2:43258065-43258087 TCAGGTGCCTCCCTTAGAAAGGG + Intronic
932532426 2:72550373-72550395 TCAGATATCTCCATTAGAAAAGG - Intronic
936968261 2:118148524-118148546 CCAGAAATCACCCTTAAAATTGG - Intergenic
938405549 2:131031231-131031253 CCAGATGCCTCCCTCAGAAGGGG + Intronic
938806388 2:134810316-134810338 CCAGATAGCCCCCCTACAATGGG + Intergenic
939476500 2:142694294-142694316 CATGATTCCTCCCTTAGAATGGG - Intergenic
940106711 2:150109339-150109361 CCAGATAACTGCATTAGAAGAGG - Intergenic
940834940 2:158510772-158510794 CAACATAGCTGCCTTAGAATAGG - Intronic
942631404 2:177953845-177953867 CCAGAGATCTCCTTTAGAAAAGG + Intronic
946465915 2:219912053-219912075 CAAGATACATCCCTCAGAAGTGG + Intergenic
947192578 2:227523080-227523102 CCAGAAACATCCTTAAGAATTGG - Intronic
1169305951 20:4490471-4490493 CCACATGCTGCCCTTAGAATGGG - Intergenic
1172089281 20:32416479-32416501 CCACATACCTCCATATGAATAGG - Intronic
1173203702 20:40973896-40973918 CAAAAAACCTCCCATAGAATGGG - Intergenic
1175270665 20:57731659-57731681 ACAGACACCACCCTAAGAATGGG + Intergenic
1175280421 20:57800632-57800654 TCAGACACCACCCTTAGAGTTGG + Intergenic
1176685428 21:9844652-9844674 CAAGATATTTCCCTTAGAAAAGG + Intergenic
1178031201 21:28528044-28528066 TCAGATACCTCCCTTACAGGAGG - Intergenic
1178881920 21:36456548-36456570 CCTCATACCTCCCTTTAAATAGG - Intergenic
950929037 3:16770923-16770945 CCAGATAGCTCCCTTATGCTGGG + Intergenic
955870563 3:63433959-63433981 CCACACACCTCCCTAAGACTGGG + Intronic
956561449 3:70580718-70580740 CCTGATACCTCCCTTTGATAAGG - Intergenic
964645695 3:158956645-158956667 CCAGATCCCTCTCTTAGAACTGG + Intergenic
964770556 3:160220642-160220664 CCAGCTATTTTCCTTAGAATTGG + Intergenic
964875069 3:161357977-161357999 ACAGATATCTTCCTTAGAAATGG + Intronic
965319647 3:167236718-167236740 GCAGATGCCTCGCTCAGAATGGG - Intergenic
967810773 3:193759140-193759162 CCAGGTCCCTCCCTTAACATGGG + Intergenic
971761952 4:30777780-30777802 CCAGATACCTCTTTAATAATAGG - Intronic
972637038 4:40893645-40893667 TCAGATTTCTTCCTTAGAATAGG + Intronic
976049961 4:80999663-80999685 TCAGATACCTCAATTAGAGTGGG + Intergenic
976588451 4:86824799-86824821 CCAAATACCTCACTTACAAGTGG - Intronic
981906571 4:149927994-149928016 CCAGTTACCTCCTTTAGAAGAGG - Intergenic
983639838 4:169934921-169934943 CCACATACCTCCCTCACAATTGG + Intergenic
984624484 4:181990553-181990575 CCATATCACTCCCATAGAATTGG - Intergenic
988455464 5:31383515-31383537 CCAGAGACATCCCTTTGAAGAGG - Intergenic
990700271 5:58467400-58467422 CTACATACCTCCCTCACAATTGG + Intergenic
993621631 5:90175641-90175663 CCAGATAACTTCCTAAGAAAAGG - Intergenic
994798004 5:104331406-104331428 CCAGATCCCTCCCTTAACATTGG + Intergenic
996949700 5:129110749-129110771 CCAGATTCCTTCCTTAGACCTGG + Intronic
997413793 5:133709794-133709816 ACAGATAGCTCCTTTAGAACTGG - Intergenic
997986793 5:138508204-138508226 ACAGATCCCTGCCTTACAATTGG - Exonic
1000624395 5:163522643-163522665 ACAGATACCTAACTTACAATGGG - Intergenic
1001609878 5:172991886-172991908 GCAGAGAGATCCCTTAGAATTGG + Intronic
1005878347 6:30033082-30033104 ACAGATCCCTGCCTTACAATTGG + Intergenic
1007226614 6:40319981-40320003 CCAGATGGCTCCTTTGGAATTGG - Intergenic
1011980647 6:93372205-93372227 TCAGATACCTCCTTTATCATTGG - Intronic
1013261030 6:108442812-108442834 CCAGAAACCCCCCTTAGTCTTGG + Intronic
1016832083 6:148444214-148444236 CCAGATACCTCCCTTAGAATAGG - Intronic
1017629999 6:156387744-156387766 ACACATACCTCCCTTAGATGTGG + Intergenic
1023511814 7:40961260-40961282 CCAGAGCCTTCCCTTAGAAAGGG - Intergenic
1024031940 7:45468759-45468781 CCTAATAGCACCCTTAGAATGGG - Intergenic
1024625509 7:51205867-51205889 GCAAATAACTCCCTTAAAATGGG + Intronic
1025639066 7:63350312-63350334 TCAGATAACTGCCTTAGTATAGG + Intergenic
1025643633 7:63397780-63397802 TCAGATAACTGCCTTAGTATAGG - Intergenic
1027600772 7:80237883-80237905 CCAGATTCCTCCCCTAACATTGG + Intergenic
1031518636 7:122735022-122735044 CCAGATGATTCTCTTAGAATTGG - Intronic
1031637235 7:124116749-124116771 CCCGATTCTTCCCTTGGAATGGG + Intergenic
1033771857 7:144561118-144561140 CCAGATAACTCCCAGAGAAGAGG - Intronic
1036748422 8:11427048-11427070 CTACATACCTCCCTCACAATTGG - Intronic
1042274855 8:66993609-66993631 ACAGATCCCTCTCTTATAATAGG + Intronic
1045373788 8:101551439-101551461 CCAGATACCTGGCTTAGTGTGGG - Intronic
1046817573 8:118601645-118601667 ACTGATCCCTCCCTAAGAATGGG + Intronic
1048192389 8:132301680-132301702 CCAGATTCTGCCCTGAGAATTGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1059919936 9:119148889-119148911 CCAGATACCTCCCTTGAGACTGG - Intergenic
1060401262 9:123350858-123350880 CCACATGCCTGCCTTAGGATGGG + Intergenic
1189869531 X:45367868-45367890 CCAGGTACCTCCCCAAAAATTGG - Intergenic
1194022412 X:88708351-88708373 CCAAATAACTCCATTAAAATTGG - Intergenic
1195432545 X:104805443-104805465 CCAAGAACCTACCTTAGAATTGG + Intronic
1195517733 X:105796749-105796771 CCAGATAACTACTTAAGAATGGG - Intergenic
1197238736 X:124098597-124098619 TGAGTTACTTCCCTTAGAATTGG - Intronic
1198823513 X:140674363-140674385 CCTGATTCTTCCCTTGGAATGGG - Intergenic
1199835242 X:151583394-151583416 CAATAAACCTCCCTTGGAATGGG - Intronic