ID: 1016832252

View in Genome Browser
Species Human (GRCh38)
Location 6:148445651-148445673
Sequence AGCCACTTTGAGGCTATGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016832252_1016832262 28 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG No data
1016832252_1016832257 -4 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832257 6:148445670-148445692 GGCTGCTGCATCTTCTAGGTGGG No data
1016832252_1016832260 20 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832260 6:148445694-148445716 AGAAAAAGCAGGGCGAAGAGAGG 0: 1
1: 0
2: 4
3: 53
4: 681
1016832252_1016832261 21 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832261 6:148445695-148445717 GAAAAAGCAGGGCGAAGAGAGGG 0: 1
1: 1
2: 5
3: 57
4: 689
1016832252_1016832255 -8 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832255 6:148445666-148445688 AAGTGGCTGCTGCATCTTCTAGG No data
1016832252_1016832256 -5 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832256 6:148445669-148445691 TGGCTGCTGCATCTTCTAGGTGG 0: 1
1: 0
2: 0
3: 28
4: 214
1016832252_1016832259 10 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832259 6:148445684-148445706 CTAGGTGGGAAGAAAAAGCAGGG No data
1016832252_1016832258 9 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832258 6:148445683-148445705 TCTAGGTGGGAAGAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016832252 Original CRISPR AGCCACTTTGAGGCTATGAC GGG (reversed) Intronic
900663700 1:3799442-3799464 AGCTACTTGGAGGCTAGGGCAGG + Intergenic
901724693 1:11231835-11231857 AGCTACTTGGAGGCTAAGATGGG - Intronic
904132989 1:28289204-28289226 AGCTACTTGGAGGCTAAGGCAGG - Intergenic
905218050 1:36424055-36424077 AGCTACTTGGGGGCTATGACGGG - Intronic
905995481 1:42377649-42377671 AGCCATTTTGTAGCTATGAGGGG + Intergenic
908138334 1:61156020-61156042 AGCTACTCGGAGGCTGTGACAGG + Intronic
910295421 1:85639939-85639961 AGCTACTTGGAGGCTGAGACAGG - Intergenic
910403653 1:86862110-86862132 AGCTACTCTGAGGCTAAGGCAGG + Intergenic
914786212 1:150834044-150834066 AGCCACTTGGAGGCTGAGGCAGG - Intronic
915302270 1:154958510-154958532 AGCCATTTTGTGGCTATTTCTGG - Exonic
916826970 1:168451674-168451696 AGCCACTTTCAGGGTTTCACTGG + Intergenic
916932223 1:169590440-169590462 AGCAACTTAGAGGGTATAACAGG - Intronic
920175251 1:204097126-204097148 AGCCACTCTGCTGCTGTGACAGG - Intronic
920410187 1:205753177-205753199 AGCTACTCTGAGGCTAAGGCAGG - Intergenic
920620348 1:207540187-207540209 AGCCATTTTAAGGATATGACTGG - Intronic
920622130 1:207558744-207558766 AGCCATTTTAAGGATATGACTGG - Intronic
920636376 1:207708384-207708406 AGCCATTTTAAGGATATGACTGG - Intronic
1065209993 10:23393873-23393895 AGCTACTTGGAGGCTGAGACAGG - Intergenic
1067795525 10:49318712-49318734 AGCAGCTTTGAGCCTATGCCAGG + Intronic
1068113567 10:52710505-52710527 AGCTACTTGGAGGCTAAGACAGG - Intergenic
1069393739 10:67965472-67965494 AGTCACTTTGAGGCTGGGTCAGG - Intronic
1069551894 10:69369848-69369870 AGCTACTTGGAGGCTAAGGCAGG - Intronic
1073296097 10:102439738-102439760 AGCTACTCTGAGGCTAAGGCAGG + Intergenic
1078320194 11:10327575-10327597 AGCCACTCTGAGACTAAAACAGG + Intronic
1078442125 11:11376979-11377001 GGTCACTTTGAGGCTGTGAATGG + Intronic
1081294016 11:41363200-41363222 AGCCCCTCTGAGGCAATGAGAGG - Intronic
1081760616 11:45574274-45574296 AACCTTTCTGAGGCTATGACAGG - Intergenic
1082135884 11:48548239-48548261 AGCATCTTTGAGGTGATGACTGG + Intergenic
1082613227 11:55328054-55328076 AGCATCTTTGAGGTGATGACTGG + Intergenic
1084824751 11:71721713-71721735 CGGCACTTTGAGGCTAAGGCGGG - Intergenic
1085581564 11:77655643-77655665 TTCCACTTTGAGGCTATGAATGG - Intergenic
1086455728 11:86956592-86956614 GGCCACTTTGAGGCTCAGAGAGG - Intergenic
1090400356 11:126444892-126444914 AGCTCCTTTGGGGCTATGCCTGG + Intronic
1091669819 12:2444985-2445007 AGGAACTTTGTGGCTATGCCTGG - Intronic
1091729436 12:2869380-2869402 AGCTACTTGGAGGCTGAGACAGG - Intronic
1092478313 12:8837766-8837788 AGCTACTTGGAGGCTGAGACAGG + Intronic
1092865224 12:12754559-12754581 AGCTACTTGGAGGCTGTGGCAGG - Intronic
1094172576 12:27509243-27509265 AGCCACCTTGGGACTATGACGGG - Intergenic
1095211239 12:39497808-39497830 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1096058892 12:48680169-48680191 AGCTACTTTGAGGCTGAGGCAGG - Intronic
1097878760 12:64668388-64668410 AGCTACTTGGAGGCTAAGGCTGG - Intronic
1098599513 12:72314087-72314109 AGCCTCTGTGAGACTGTGACAGG + Intronic
1098925960 12:76349559-76349581 AGCGACTTGAAGGCTAAGACAGG - Intergenic
1099215556 12:79849273-79849295 AGCTACTTGGAGGCTAAGACAGG + Intronic
1099426309 12:82527870-82527892 GGCCACTTTAACACTATGACAGG - Intergenic
1099465800 12:82986553-82986575 AGCCAATTTGGGGCTAACACTGG - Intronic
1099837245 12:87922320-87922342 AGCATCTTTAGGGCTATGACAGG + Intergenic
1102194215 12:111012993-111013015 AGCCACTTTGGGGCCATTAGGGG - Intergenic
1102369137 12:112366766-112366788 AGCTACTTGGAGGCTAAGGCAGG + Intronic
1102385925 12:112510209-112510231 AGCTACTTGGAGGCTGAGACGGG + Intergenic
1102777557 12:115533692-115533714 AGCCACTTTGTGACCATGAGGGG - Intergenic
1102779613 12:115552801-115552823 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1103439938 12:120955511-120955533 AGCCACTTTGTGACCATGAGGGG + Intergenic
1103531098 12:121602408-121602430 AGCCACTCTGAGGCTGAGCCAGG - Intergenic
1103972398 12:124680259-124680281 AGCCATCTTGAGGCCATGAAGGG - Intergenic
1105026617 12:132853371-132853393 AGTCACTTTGTGGCTGTGCCCGG - Intronic
1108199736 13:48031370-48031392 AGCCAGCTTGAGGCTGTGCCTGG + Intergenic
1108325816 13:49330040-49330062 AGCCACCTTGAGGTTATCTCTGG - Intronic
1111010749 13:82310963-82310985 AGCCACTTGGAGGCTGAGGCAGG + Intergenic
1111187215 13:84753905-84753927 AGCCTCTTGGTGGCTATGAGTGG + Intergenic
1111205021 13:84995977-84995999 AGCTACTTGGAGGCTAAGGCAGG - Intergenic
1111517314 13:89351385-89351407 AGAGACTTTGAGGCCGTGACAGG + Intergenic
1112300860 13:98228612-98228634 AGACCCTTTAAGGCTGTGACTGG + Intronic
1113384293 13:109834018-109834040 AGTCACCCTGAGGCTATGATGGG + Intergenic
1113384518 13:109836393-109836415 ATCCACTTTGAGGCTGTTAAAGG + Intergenic
1114198480 14:20500691-20500713 AGCTACTTGGAGGCTGAGACAGG - Intergenic
1114421751 14:22589585-22589607 ATCTACTTTGAGGCAATGCCTGG + Intergenic
1114831434 14:26146724-26146746 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1115231591 14:31166494-31166516 AGCCAATTAGAAGCTATGAAGGG + Intronic
1116770193 14:49118515-49118537 AGCCATCTTGAGGTTATGAGGGG - Intergenic
1117770162 14:59126217-59126239 AGCTACTTGGAGGCTGAGACAGG - Intergenic
1120380100 14:83766310-83766332 AGCCACCTTGAGTCTATGTAGGG + Intergenic
1120645597 14:87070429-87070451 AGCTACTTGGAGGCTAAGGCAGG + Intergenic
1121185385 14:91962904-91962926 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1121726533 14:96156083-96156105 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1123721984 15:23068272-23068294 AGCCACTTGGAGGCTGAGGCAGG - Intergenic
1124813401 15:32964636-32964658 AACCAATTTGAGACTGTGACAGG + Intronic
1126097209 15:45098070-45098092 AGGCACCTTGAGCCTCTGACTGG + Intronic
1127533149 15:59864886-59864908 AGCCACTTTGCTGCTATGTGTGG + Intergenic
1127838534 15:62810142-62810164 TGCCACTGTGAGGCTGGGACTGG + Intronic
1127940455 15:63690049-63690071 AGCTACTTGGAGGCTAAGGCAGG + Intronic
1130037552 15:80375479-80375501 AGCCACTTTGAGTCCCTGAAGGG - Exonic
1130395965 15:83501777-83501799 AGCTACTTGGAGGCTGTGGCAGG + Intronic
1130612016 15:85369899-85369921 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1131094046 15:89645099-89645121 CGCCACTCTGAGGCTGTGGCAGG + Exonic
1132402911 15:101524569-101524591 AGCCACTTGGCTGCTATGAATGG - Intronic
1132469600 16:94638-94660 AGCTACTTGGAGGCTGAGACAGG + Intronic
1134127816 16:11628613-11628635 AGCTACTTGGAGGCTAAGGCGGG - Intronic
1134169482 16:11957102-11957124 AGCCACTTGGAGGCTGAGGCAGG - Intronic
1135061327 16:19273502-19273524 AGCTACTTGGAGGCTAAGGCAGG + Intergenic
1137447525 16:48540778-48540800 AGCCACACTGAGGCTAGTACTGG + Exonic
1142394954 16:89826977-89826999 AGCTACTTTGAGGCTGAGGCAGG + Intronic
1143372771 17:6450538-6450560 AGACACTCTCAGGCTATGGCAGG - Exonic
1144768867 17:17747950-17747972 AGCTACTTGGAGGCTAAGGCTGG + Intronic
1144884499 17:18449216-18449238 ATCCACTTTGGGGCTAAGCCTGG + Intergenic
1145147730 17:20495161-20495183 ATCCACTTTGGGGCTAAGCCTGG - Intergenic
1146991013 17:37272229-37272251 AGCCACTTGGAGGCTGAGGCAGG + Intronic
1147229781 17:39009189-39009211 AGCTACTTGGAGGCTAAGTCAGG - Intergenic
1147573895 17:41587840-41587862 AGCCACTTTGGGGCTAAGCCTGG - Intergenic
1148117195 17:45183111-45183133 GGCCACTTGGAGGCCAGGACAGG + Intergenic
1149147820 17:53518938-53518960 AGCTACTCAGAGGCTAAGACAGG - Intergenic
1149355807 17:55838027-55838049 AGCTACTTGGAGGCTGAGACAGG + Intronic
1149603234 17:57906857-57906879 AGCTACTTTGAGGCTGAGGCAGG + Intronic
1156151848 18:34252303-34252325 AGCTAGTTTCAGGCTATGACAGG - Intergenic
1156469672 18:37369310-37369332 AGGCACCTGGAGGCAATGACTGG - Intronic
1157767600 18:50312270-50312292 AGCTACTATGAGGCTGAGACAGG - Intergenic
1158105062 18:53876081-53876103 AGCCACTCGGAGGCTGAGACAGG + Intergenic
1158415861 18:57249289-57249311 AGCTGCTTTGAGGCCAGGACAGG - Intergenic
1160458628 18:79020603-79020625 AGCCACTTGGAGGCTGAGGCAGG - Intergenic
1161074282 19:2277676-2277698 AGCTACTTGGAGGCTAAGGCAGG - Intronic
1161909508 19:7182221-7182243 AGCTACTTAGAGGCTAAGGCAGG + Intronic
1162400179 19:10441145-10441167 AGCTACTGGGAGGCTAAGACTGG - Intronic
1163479702 19:17547777-17547799 AGCTACTTGGAGGCTGAGACAGG - Intronic
1165679163 19:37758486-37758508 AGCTACTTGGAGGCTGTGGCAGG + Intronic
1165911414 19:39230558-39230580 AGCCACCTTGTGCCTATGAGGGG - Intergenic
1166141416 19:40807327-40807349 AGTCACTCTGAGGCTCTGACAGG - Intronic
1168041177 19:53759923-53759945 AGCTACTTGGAGGCTAAGGCAGG + Intergenic
1168542416 19:57224157-57224179 AGCTACTTGGAGGCTAAGATAGG + Intergenic
926664876 2:15510286-15510308 AGCCCCTTTGAAGCTAGGAGGGG + Intronic
927759972 2:25744032-25744054 AGACACTATGAGGCTGTGCCTGG + Exonic
928419421 2:31126290-31126312 AGCCACGTTGAGTCTGTGAAAGG - Intronic
929446491 2:42005628-42005650 AGCCACTCTCAGGCCATGTCTGG - Intergenic
934861212 2:97764836-97764858 AGCCAGTTTGTGGCTGTGTCTGG + Intronic
938631461 2:133172581-133172603 AGCTACTTGGAGGCTGAGACAGG - Intronic
942623519 2:177874581-177874603 GGCATCTTTGAGGCTATAACAGG - Intronic
944711076 2:202335793-202335815 AGACACTCTCAGGCTATGGCAGG + Intergenic
944783858 2:203047853-203047875 AGCTACTTGGAGGCTAAGGCAGG - Intronic
945142781 2:206705020-206705042 AGTCTCTTTGTGGCTATGAAAGG + Intronic
948470674 2:238175894-238175916 AGCCACTTGGAGGCTGAGGCAGG - Intronic
1169545289 20:6643909-6643931 AGCCACCTTGTGACTATGAGAGG + Intergenic
1174823207 20:53745217-53745239 AGCTACTTGGAGGCTAAGGCAGG + Intergenic
1175134272 20:56811159-56811181 AGCCACGTTTAGACTATGAGGGG + Intergenic
1177255830 21:18661910-18661932 AGACAGTTTCAGGCCATGACGGG + Intergenic
1179262680 21:39772371-39772393 AGCCACTTGGAGGGTATAAGAGG + Intronic
1180172647 21:46067802-46067824 AGCCACTTCGAGGCTCTCACCGG + Intergenic
1184016515 22:41789866-41789888 AGTCACTGTGAGGCTAAGACAGG - Intronic
952295497 3:32058774-32058796 AGCCACTGGGAGGCTAAGGCAGG - Intronic
953417682 3:42732299-42732321 GGCCACTTGGAGGCTTTGCCTGG + Intronic
953707728 3:45243872-45243894 AGCCACTTGGAGGCTGAGGCAGG + Intergenic
954128316 3:48545799-48545821 AAGCACTTTGAGGCTTTAACTGG - Intronic
954566284 3:51602940-51602962 AGGTACTTGGAGGCTAAGACAGG - Intronic
955171960 3:56574791-56574813 AGCCAGTTAGAGGCTGAGACAGG - Intronic
955300886 3:57777471-57777493 AGCTACTTGGGGGCTAAGACGGG + Intronic
955328719 3:58029614-58029636 AGCTACTTGGAGGCTAAGGCAGG - Intronic
955530848 3:59871639-59871661 AGCTACTTGGAGGCTGTGTCTGG + Intronic
956421697 3:69092580-69092602 AGCTACTTGGAGGCTAAGGCAGG - Intronic
956931237 3:74045789-74045811 AGCCACTCTGAGGCTCAGAGAGG + Intergenic
958896252 3:99832726-99832748 AGCTACTTGGAGGCTAAGGCAGG + Intronic
958988964 3:100819523-100819545 AACAACTGTGAGGCTATCACAGG - Intronic
959670138 3:108967739-108967761 AGCCACTTCAAGGCTAAGCCAGG + Intronic
961697867 3:128718572-128718594 AGCTACTTGGAGGCTGAGACAGG + Intergenic
962597326 3:136959868-136959890 AGCCACTTTGAGGTTATGAGGGG + Intronic
963094354 3:141520123-141520145 AGCTACTTGGAGGCTAAGGCAGG - Intronic
965671286 3:171150545-171150567 AGCCACTTGGTGGCAATGATGGG + Intronic
968146565 3:196304242-196304264 AGCCACTTGGAGGCTGAGGCAGG - Intronic
970881136 4:20933130-20933152 AGCTACTTCGAGGCTGAGACAGG + Intronic
971652474 4:29295831-29295853 AGCTACTTGGAGGCTATGGTGGG + Intergenic
972033591 4:34493428-34493450 AGCTACTTTGAGGCTGAGGCAGG + Intergenic
972113008 4:35589723-35589745 TGCCACTGGGAGGCTATGACTGG + Intergenic
972183072 4:36493539-36493561 AGCCACTGTGAAGCTAACACAGG + Intergenic
972685055 4:41344359-41344381 AGCTACTTGGAGGCTAAGGCAGG + Intergenic
972773486 4:42220030-42220052 AGCTACTTGGAGGCTAAGATGGG - Intergenic
974044072 4:56882641-56882663 AGCTACTTAGAGGCTGCGACAGG - Intergenic
977706139 4:100072276-100072298 AGACACTTTGAGGGTCTGAGAGG + Intergenic
977964938 4:103134519-103134541 AGCTACTTGGAGGCTGTGGCAGG + Intronic
982168208 4:152635225-152635247 AGCCACCATGAGGCTAATACAGG - Intronic
982717950 4:158828502-158828524 AGCTACTTGGAGGCTGAGACAGG + Intronic
986109468 5:4697702-4697724 AGCTACTAGGAGGCTATGGCAGG - Intergenic
988287265 5:29236190-29236212 ACCCATTTTGAGGGAATGACAGG - Intergenic
990204413 5:53413703-53413725 AGCCACTTGGAGGCTGAGGCAGG + Intergenic
990893187 5:60670269-60670291 AGCTACTATGAGGCTAAGGCAGG + Intronic
991496771 5:67234679-67234701 AAGTACTTTGAGGCCATGACAGG + Intergenic
997658288 5:135571344-135571366 AGTCACACTGAGGCTGTGACCGG + Exonic
997964405 5:138345984-138346006 ACCCACTTTGAAGCAGTGACAGG - Intronic
999972324 5:156877434-156877456 AGCCACCTCATGGCTATGACGGG - Intergenic
1001200354 5:169710415-169710437 AGCCAATGTGAGCCTATCACAGG + Intronic
1005757128 6:28934927-28934949 AGCTACTTGGAGGCTGAGACAGG - Intergenic
1006991527 6:38218724-38218746 AGCCATACTGAGGCTATGATGGG + Intronic
1010714539 6:79213126-79213148 AGCCACTTGGAGGCTGAGATGGG + Intronic
1011138129 6:84121530-84121552 AGCTACTTGGAGGCTGAGACAGG + Intergenic
1011953140 6:92992650-92992672 AGCCACTTGGAGGCTGAGGCGGG + Intergenic
1013376434 6:109519681-109519703 AGCTACTTGGAGGCTGAGACAGG + Intronic
1015160039 6:130142760-130142782 AGCCTCTCTCAGGCCATGACAGG - Intergenic
1016832252 6:148445651-148445673 AGCCACTTTGAGGCTATGACGGG - Intronic
1018180487 6:161218671-161218693 AGCCACTTGGAAGCTATAAAGGG + Intronic
1018447419 6:163870280-163870302 TGCCACTGTGAGGCGATGGCTGG + Intergenic
1018856410 6:167678468-167678490 AGCCCGTGTGAGGCTATGACGGG - Intergenic
1021677201 7:23092871-23092893 AGCTACTTAGAGGCTAAGGCAGG + Intergenic
1023935859 7:44739272-44739294 GGACCCTGTGAGGCTATGACTGG + Intergenic
1025183127 7:56834425-56834447 AGCCCTTTGGAGGCTAAGACAGG - Intergenic
1025688800 7:63742551-63742573 AGCCCTTTGGAGGCTAAGACAGG + Intergenic
1025912009 7:65836716-65836738 AGCCCTTTGGAGGCTAAGACAGG + Intergenic
1026193048 7:68147136-68147158 TGCCTCTTTGAGAATATGACTGG - Intergenic
1026353622 7:69538709-69538731 AGCCTCCAGGAGGCTATGACAGG + Intergenic
1026657111 7:72266414-72266436 AGACACTTTAAGGCCATCACTGG + Intronic
1029148309 7:98462579-98462601 AGCCACTTGGAGGCTGAGGCAGG - Intergenic
1029311987 7:99675940-99675962 AGCCTCTGTGAGGCCAAGACTGG - Intronic
1029600653 7:101561477-101561499 AGCCACTTGGAGGCTGAGGCAGG + Intergenic
1030984011 7:116219655-116219677 AGCAACTATGAGGCTAGGGCAGG + Intronic
1031765977 7:125777940-125777962 AGCTACTTGGAGGCTAAGACAGG + Intergenic
1034606760 7:152323525-152323547 AGCCACTTGGAGGCTGTGGTGGG + Intronic
1037210144 8:16376031-16376053 AGCCAGTTTGATGCTAGGATGGG - Intronic
1037790856 8:21940579-21940601 AGCTACTGGGAGGCTAAGACAGG - Intronic
1040509055 8:48077471-48077493 AGCTACTTGGAGGCTAAGGCAGG - Intergenic
1042500318 8:69501779-69501801 ACCCCCTTTGAGGCTGTGAAAGG + Intronic
1047192429 8:122690279-122690301 AGCCACCTTGAAGCTATGAGGGG - Intergenic
1047614106 8:126548919-126548941 AGCTACTTTGAGGCTGAGACAGG - Intergenic
1047649282 8:126901934-126901956 AGCCACTTGGAGGCTGAGATGGG + Intergenic
1048891755 8:138954515-138954537 AGACTGTTTCAGGCTATGACAGG + Intergenic
1049743858 8:144254773-144254795 AGTCACTTTGAGGCCGTGGCTGG - Intronic
1049859116 8:144885574-144885596 AGCCACATGGAGGCTGAGACAGG - Intronic
1052926131 9:34018073-34018095 AGCTATTTTGAGGCTAAGATGGG + Intronic
1053538538 9:38949639-38949661 AGCCACCTTGAGGTCATCACTGG - Intergenic
1054627600 9:67414280-67414302 AGCCACCTTGAGGTCATCACTGG + Intergenic
1054883730 9:70173149-70173171 AGCCACTGTGTTGCCATGACAGG - Intronic
1055308863 9:74957560-74957582 AGTCACTTTGAGTATATGACTGG - Intergenic
1056763863 9:89432956-89432978 GGTCACTTTGAGGACATGACTGG - Intronic
1061761818 9:132856756-132856778 AGCCACTTCGTGGGCATGACGGG + Intronic
1061932323 9:133839560-133839582 AGCTACTTGGAGGCTGAGACAGG - Intronic
1186023571 X:5283897-5283919 AGCTACTCTGAGGCTGAGACAGG + Intergenic
1186389380 X:9143564-9143586 TGCCACTATGAGGCTAGGAGTGG - Intronic
1188120954 X:26306458-26306480 AGCCATTTTGTGACTATGAAAGG + Intergenic
1190185672 X:48231777-48231799 AGACAGTTTCAGGCCATGACAGG - Intronic
1190552439 X:51598736-51598758 AGCTACTTGGAGGCTAAGGCGGG - Intergenic
1195288275 X:103406431-103406453 AGCCACTTTGATCTTATCACTGG + Intergenic
1195318843 X:103704849-103704871 AGCCACTCAGAGGCAATGCCAGG - Intergenic
1195519930 X:105819454-105819476 ACCTACTCTTAGGCTATGACTGG + Intergenic
1199521878 X:148745197-148745219 AACCACATTGAGGAAATGACTGG - Intronic
1200169858 X:154064800-154064822 AGCTTCTTTGGGGCTCTGACAGG - Intronic
1200700457 Y:6397843-6397865 AGTCACTTTGAGACTGTGAAAGG + Intergenic
1200749953 Y:6935784-6935806 AGCTATTTGGAGGCTAAGACAGG + Intronic
1201033655 Y:9766855-9766877 AGTCACTTTGAGACTGTGAAAGG - Intergenic