ID: 1016832254

View in Genome Browser
Species Human (GRCh38)
Location 6:148445661-148445683
Sequence AAGATGCAGCAGCCACTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 197}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016832254_1016832260 10 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832260 6:148445694-148445716 AGAAAAAGCAGGGCGAAGAGAGG 0: 1
1: 0
2: 4
3: 53
4: 681
1016832254_1016832259 0 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832259 6:148445684-148445706 CTAGGTGGGAAGAAAAAGCAGGG No data
1016832254_1016832258 -1 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832258 6:148445683-148445705 TCTAGGTGGGAAGAAAAAGCAGG No data
1016832254_1016832262 18 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG No data
1016832254_1016832263 25 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832263 6:148445709-148445731 AAGAGAGGGAAGAAGGCAGTAGG 0: 1
1: 0
2: 13
3: 132
4: 1354
1016832254_1016832261 11 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832261 6:148445695-148445717 GAAAAAGCAGGGCGAAGAGAGGG 0: 1
1: 1
2: 5
3: 57
4: 689

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016832254 Original CRISPR AAGATGCAGCAGCCACTTTG AGG (reversed) Intronic
900709173 1:4101698-4101720 CAGATGCTCCAGCCACTCTGCGG - Intergenic
900794124 1:4697812-4697834 AAGATGCAGCGGCCACTAATGGG + Intronic
901146805 1:7070322-7070344 AATATGCAGCAGCCACATCTGGG + Intronic
901777494 1:11570411-11570433 CAGAAGCAGCAGCAAATTTGTGG + Intergenic
902145539 1:14395714-14395736 AAGATGCAGCACGGACTTGGCGG + Intergenic
902197323 1:14807261-14807283 AAGAGGCAGCAGCCACCTTGGGG + Intronic
902284735 1:15400102-15400124 AAGCTGGAGCAGCCACCTTGGGG + Intronic
902743135 1:18454325-18454347 GAGAAGCAGCAAGCACTTTGGGG + Intergenic
902975563 1:20085769-20085791 AAGATGTAGCTGCTAATTTGGGG + Intronic
903344049 1:22673262-22673284 AGGAGGCAGCAGCCACTTTGGGG - Intergenic
904721583 1:32513738-32513760 AAAATGGTACAGCCACTTTGGGG + Intronic
905122909 1:35695497-35695519 AAGATGCAGCCTCCACTCTCTGG + Intergenic
905921277 1:41720606-41720628 AAAATGGTGCAGCCACTATGGGG + Intronic
905959384 1:42031054-42031076 AAGATACAGTCTCCACTTTGAGG - Intronic
906206569 1:43990598-43990620 AAGTTTCAGAACCCACTTTGGGG + Exonic
906845513 1:49187136-49187158 AAGACACAGCAGCCTTTTTGGGG + Intronic
909920127 1:81371118-81371140 AAAATGCAGCAGCATCTTTAGGG + Intronic
911704082 1:100990552-100990574 AAATTGCAGCAGGCACTTTAAGG - Exonic
913252870 1:116926542-116926564 AAGATGCAAAAACCACTTAGAGG - Intronic
913398202 1:118396553-118396575 AAGATGCAGCAGACAGCTTAGGG - Intergenic
921431923 1:215075942-215075964 AAGAAGCATCAGGTACTTTGGGG + Intronic
922932628 1:229402358-229402380 AAGATGCAGCATCGAGATTGTGG + Intergenic
923355422 1:233150253-233150275 AAGAAGCAGTACCCACTGTGGGG - Intronic
923377536 1:233379429-233379451 CATCTGCAGCAGGCACTTTGTGG - Exonic
923962114 1:239097181-239097203 AAGATTCAGCAACCAATTTGAGG - Intergenic
924032386 1:239899521-239899543 AAAATGCAACAGCCAATTAGCGG + Intronic
1063024206 10:2162037-2162059 AAAGAGCAGCAGACACTTTGGGG - Intergenic
1064989993 10:21247973-21247995 AAGATTCAGAAGCAACTCTGAGG + Intergenic
1067180827 10:43984860-43984882 AGGCTACAGCAGCCACCTTGAGG - Intergenic
1068949524 10:62763150-62763172 AAGATGCCCAAGCCACTTTTAGG - Intergenic
1071586995 10:86833144-86833166 AAAATGATGCAGTCACTTTGAGG - Intronic
1073684961 10:105742210-105742232 AAGATCAAACAGCCACTTGGTGG - Intergenic
1073819904 10:107249898-107249920 AGCATGCATCTGCCACTTTGTGG + Intergenic
1074969624 10:118525414-118525436 AAGGTACAGTAGCCATTTTGAGG - Intergenic
1078136710 11:8657856-8657878 CAGAAGCAGCAGTCACTTTAGGG - Intronic
1078501031 11:11876671-11876693 CAGAGGAAGCAGCCACTTGGTGG - Intronic
1079925072 11:26483753-26483775 AAAATGTAGAAGCAACTTTGGGG + Intronic
1080426627 11:32160749-32160771 AAGATGGAACAGACTCTTTGTGG - Intergenic
1081216728 11:40408644-40408666 AAAATGCAAAAGCCATTTTGGGG - Intronic
1083902258 11:65649363-65649385 CAGGTGCAGCAGCTGCTTTGTGG - Exonic
1085665813 11:78415315-78415337 CAGAAGCAGCAGCTACTTTGGGG + Intronic
1086107344 11:83159649-83159671 AAGATGTAAAAGTCACTTTGGGG + Intronic
1091595053 12:1872649-1872671 AAGAAAACGCAGCCACTTTGGGG + Intronic
1091648761 12:2294009-2294031 AATATGCACCAGCCACTGTCAGG + Intronic
1096023845 12:48344427-48344449 ATGATGTAGCAGGCACTTTGTGG - Intronic
1100424931 12:94475414-94475436 AAGATAAACCAGCCACTTGGTGG - Intergenic
1100793361 12:98154344-98154366 TAGATGCAGCAGCCACCTCAGGG - Intergenic
1101586090 12:106087293-106087315 AAGATTGAGCACCCATTTTGGGG - Intronic
1104079390 12:125416973-125416995 CTGCTGCAGCAGCCACTTTGAGG - Intronic
1106837754 13:33654087-33654109 AAAATGGTGCTGCCACTTTGGGG + Intergenic
1107096720 13:36545434-36545456 AAGATGCAGCAGACGCTCAGGGG + Intergenic
1110655103 13:77988515-77988537 ATGACACAGCAGCCACATTGAGG - Intergenic
1111294206 13:86258153-86258175 TTGCTGCAGCAGCCCCTTTGAGG - Intergenic
1111644613 13:91015555-91015577 AAGATGAAGTATACACTTTGTGG - Intergenic
1112112637 13:96319576-96319598 AAAATGATGCAGCCACTTTGGGG - Intronic
1113072869 13:106438579-106438601 AAGGTGCAGAAGCAACTTGGAGG - Intergenic
1113802776 13:113095213-113095235 AAGGTGCAGCAGACACTTCTTGG - Intronic
1114852836 14:26401306-26401328 AAGGCGCAGCATGCACTTTGGGG + Intergenic
1119951626 14:78751565-78751587 CAGATGCTTCACCCACTTTGAGG - Intronic
1120118399 14:80648121-80648143 AAAAATCAGCAGCAACTTTGTGG + Intronic
1121596832 14:95170066-95170088 AAGATGTAGTAGCGGCTTTGAGG + Intergenic
1121977381 14:98417802-98417824 CAAAGGCAGCAGCCACCTTGAGG - Intergenic
1122854813 14:104554958-104554980 AAGGGGCCGCAGCCACTCTGAGG - Intronic
1122878474 14:104679431-104679453 CAGCCGCAGCAGCCACTCTGTGG + Intergenic
1122928925 14:104924451-104924473 GAGTTCCAGCAGCCACTGTGAGG + Intergenic
1125599654 15:40908207-40908229 CAGAAGCAGCAGCCACCTTCCGG - Intergenic
1133113983 16:3565497-3565519 AGGCAGCAGCAGCCACTCTGGGG + Intronic
1133611445 16:7437297-7437319 AACAGGCAGCTCCCACTTTGAGG + Intronic
1134028398 16:10972252-10972274 CAGAAGCAGCTGCCCCTTTGGGG + Intronic
1134903305 16:17958186-17958208 GGAATGCAGCAGCCATTTTGTGG + Intergenic
1135124540 16:19797585-19797607 TTGCTGCAGCAGCCCCTTTGAGG + Intronic
1135230249 16:20699617-20699639 GAGAAGGAGCAGCCACTTTTCGG + Intronic
1136155512 16:28379565-28379587 AAAAAGCAGCAGGCTCTTTGAGG + Exonic
1136207572 16:28735724-28735746 AAAAAGCAGCAGGCTCTTTGAGG - Exonic
1137758540 16:50921699-50921721 AAGGAGAAGCAGGCACTTTGTGG + Intergenic
1140452873 16:75085614-75085636 AAAATGACACAGCCACTTTGGGG - Intronic
1140584848 16:76277312-76277334 AGGATGCTGCTGCCAATTTGTGG + Intronic
1143501778 17:7343492-7343514 AAGAGGCAGGAGCTGCTTTGAGG + Exonic
1147260539 17:39207423-39207445 AAGATCCAGCAGTTACTTTAGGG - Intergenic
1148062472 17:44846325-44846347 GAGATGGAGCTGCCACTATGGGG - Intergenic
1148084823 17:44987782-44987804 AAAACGCAGCAGCCGCTTAGAGG + Intergenic
1148128086 17:45247085-45247107 AGGATGCACCAGCCCGTTTGAGG - Exonic
1148861520 17:50606810-50606832 CTGATGCAGGAGGCACTTTGGGG + Intronic
1150756182 17:67916230-67916252 AAGAAGCTGCAGCAACTTTTTGG + Intronic
1151258456 17:72898118-72898140 CAGATGCACCAGACACTTTTTGG - Intronic
1151994484 17:77600155-77600177 AAGGTACAGCAGACACTTTCTGG + Intergenic
1156113808 18:33761543-33761565 CAGATGGAGCAGCCACTGGGTGG - Intergenic
1156286914 18:35705860-35705882 AAGCTGCAGCAACCACCTTGTGG - Intronic
1158365595 18:56731169-56731191 AAGTTGCATCAGGGACTTTGTGG + Intronic
1158726619 18:59979045-59979067 AGGTGGCATCAGCCACTTTGGGG + Intergenic
1158777079 18:60595887-60595909 AATATTCATCAGCCAATTTGTGG + Intergenic
1159380269 18:67647474-67647496 AAGATAAAGCAGCCAGTTAGGGG + Intergenic
1159525354 18:69581878-69581900 GACATGCAGCAGTCATTTTGTGG + Intronic
1160395020 18:78564434-78564456 AGGATGCAGCAGTCACATTCAGG - Intergenic
1160470097 18:79124068-79124090 AAAGTGGTGCAGCCACTTTGAGG + Intronic
1160549205 18:79682244-79682266 AAGGTGCAGCAGGCATTTTGGGG - Intronic
1160992760 19:1866874-1866896 AAGAGGCAGCAGACACTTTGGGG + Intergenic
1163496962 19:17652091-17652113 AAGATAAAGCAGACACTATGAGG - Intronic
1164093071 19:21978055-21978077 AAAATGCAGCAGCCACATTCAGG + Intronic
1166893224 19:46007383-46007405 AGGATCCAGCAGCTATTTTGTGG - Intronic
1168236309 19:55065596-55065618 GAGGTGCAACAGCCACTGTGTGG - Intronic
926063135 2:9816911-9816933 AAAATCCACCAGTCACTTTGCGG + Intergenic
931662940 2:64585480-64585502 CAAATGCATCAGTCACTTTGAGG - Exonic
932630426 2:73337885-73337907 AAAATGATGCAGCCACTTTGGGG + Intergenic
937989940 2:127656764-127656786 AAGAGGCAGGAGCCACCTCGGGG - Intronic
938688273 2:133762390-133762412 AAGATGCAGCTGCCAAAATGGGG + Intergenic
939201387 2:139039771-139039793 AAGATAGAGCAGACACTTTTAGG - Intergenic
940102615 2:150059215-150059237 AAGCTGCACCAGCCAATTTTAGG - Intergenic
941508684 2:166378133-166378155 AAAATGCTCCAGCCACTTTGAGG - Intergenic
944934768 2:204556360-204556382 AAGATAAAGCAGCCACTCTCGGG + Intronic
945013955 2:205494719-205494741 AAAATGCAGCAGGCATTCTGTGG - Intronic
946453415 2:219800485-219800507 AAGATACAGCATCTACCTTGGGG + Intergenic
946493790 2:220175373-220175395 TCTATGCAGCAGCCACTTTCTGG + Intergenic
1169130052 20:3161929-3161951 GAGCTGTGGCAGCCACTTTGTGG + Intergenic
1170788415 20:19487804-19487826 AAGATACTGATGCCACTTTGAGG + Intronic
1170797888 20:19565540-19565562 AAGAAGCAGCAGCCAATGAGGGG - Intronic
1170857502 20:20070696-20070718 ATGATATTGCAGCCACTTTGGGG - Intronic
1173737552 20:45372800-45372822 AGCACGCAGCAGCCACTATGAGG + Exonic
1174470748 20:50758893-50758915 AGTATGCAGCAGCCACATGGGGG - Intergenic
1174486030 20:50861744-50861766 AACATGAAGCAGCCACATAGGGG - Intronic
1174868392 20:54160852-54160874 AAGCTGCAGCAGCTGATTTGAGG + Intronic
1175566094 20:59978310-59978332 AAAATGGTGCAGCCACTTTGGGG - Intronic
1177608069 21:23407979-23408001 CAAATGCAGCATCCAGTTTGTGG - Intergenic
1178032137 21:28540069-28540091 GACATGCAGCAGCCATCTTGTGG + Intergenic
1181430509 22:22878745-22878767 GAGCTGCAGCAGCCACCCTGAGG - Intronic
1183143011 22:35961884-35961906 GAGGTGAAGCAGCCACTTTTGGG - Intronic
949334169 3:2955457-2955479 GAGCTGCTGCAGCCATTTTGTGG - Intronic
949861447 3:8508905-8508927 AAGGTCCAGAAGCCACTTCGAGG + Intronic
949878304 3:8641557-8641579 AAGATACAGCATCTACTTTGGGG - Intronic
951222521 3:20083838-20083860 AAGAGGTAGCTGCCATTTTGAGG + Intronic
952697494 3:36285459-36285481 AAGATCAAGCAGCCAATCTGGGG - Intergenic
952816050 3:37449115-37449137 GAGATGCAGCAGCTGTTTTGAGG - Intergenic
954014297 3:47673046-47673068 AAGCTTCAGCAGTCATTTTGTGG - Intronic
954378697 3:50208110-50208132 GAGGTGCAGCAGCCTTTTTGTGG + Intronic
955202839 3:56866526-56866548 AAAATACAGGAGCCACTTTGAGG - Intronic
957271241 3:78032896-78032918 AAGACACAGCAGCCACTGTTTGG + Intergenic
957480418 3:80785669-80785691 AAAATGCTGCAACCACTTTTTGG - Intergenic
960380237 3:116951291-116951313 AACAGGCAGCTGCCACTTTGGGG + Intronic
961814154 3:129539849-129539871 AAGATGCGGCATCTACTCTGAGG + Intergenic
962082965 3:132160091-132160113 AAGAGGCAGCAGCCATCTTGGGG + Intronic
962502278 3:136007620-136007642 AATATGCTGTAGCCATTTTGAGG + Intronic
962807196 3:138936261-138936283 CAGGTGCGGCAGCCACTCTGGGG + Intergenic
965209829 3:165770597-165770619 AATATTCAGCAGCCAATTTCTGG + Intergenic
966106810 3:176345608-176345630 ACCATGCTGCAGCCACTTGGGGG + Intergenic
966299221 3:178460235-178460257 AAGATGGAGCCGCCATCTTGAGG + Intronic
967548067 3:190755888-190755910 AATATGCAGCAGTCACAATGGGG + Intergenic
969294806 4:6263544-6263566 AGGATGCAAAAGCAACTTTGAGG - Intergenic
973100452 4:46262051-46262073 CAGTTGCATAAGCCACTTTGGGG + Exonic
973589953 4:52431024-52431046 AAGGAGCAGAAGCCAGTTTGAGG - Intergenic
975838252 4:78447324-78447346 CAGATGCAGAAGCCACTTTTGGG + Intronic
976555504 4:86446651-86446673 AAGTTGGCGCAACCACTTTGGGG - Intronic
977002136 4:91518289-91518311 ATGATGGAGCAGCCGCTCTGTGG + Intronic
978866699 4:113521345-113521367 CAGATGCAGGAACCACTTTGAGG - Intronic
981946816 4:150356284-150356306 AAGCAAGAGCAGCCACTTTGCGG + Intronic
981985496 4:150849694-150849716 ATGATGCAGCAGGCATTTGGAGG + Intronic
982131453 4:152232512-152232534 ATGATGCTGCAGCTACTCTGTGG - Intergenic
983051105 4:163048638-163048660 AAGATGAAGCAGCCACCTGGTGG - Intergenic
983066901 4:163221266-163221288 AATATGTAGCAGACACTTAGTGG + Intergenic
986836145 5:11639645-11639667 AAGATGCATTAGCCTCTTAGAGG - Intronic
988423102 5:31030158-31030180 AAAGTGCAACAGCCATTTTGAGG + Intergenic
991999348 5:72420093-72420115 AAAACACAGAAGCCACTTTGTGG - Intergenic
992014461 5:72561401-72561423 AATCTGCAGCAGCCACTTAAAGG + Intergenic
994110050 5:95992090-95992112 AATATGCAGCAGCTACTTAAAGG + Intergenic
999038492 5:148381242-148381264 AAGATGTAGCAAAGACTTTGTGG - Intergenic
999214404 5:149919893-149919915 AAGATGTAGCTGACACTGTGAGG + Intronic
999356618 5:150940567-150940589 AAAATAGAGCAGCCACTTTTTGG + Intergenic
999555213 5:152734033-152734055 AGGGTGCATCAGCCAGTTTGGGG + Intergenic
1000987267 5:167874765-167874787 AGGATGCAGCAGCCTCTGTGTGG + Intronic
1003915296 6:10781165-10781187 AAGATGAAGCAGCCAAAATGAGG + Intronic
1004784725 6:18954847-18954869 AAGATACAGCATAAACTTTGTGG - Intergenic
1005698389 6:28373258-28373280 AAGGTGCAGAAGCCACTGAGTGG - Intergenic
1005765939 6:29012168-29012190 AAGATTAAGCAGCCATTTGGTGG + Intergenic
1006489044 6:34370372-34370394 GAGTTGTAGCCGCCACTTTGAGG - Intronic
1010111739 6:72244165-72244187 AAGAGGCATCAGCCATCTTGAGG + Intronic
1010863569 6:80943900-80943922 AAGATCCAGGAGCCACTATGTGG - Intergenic
1010975914 6:82313336-82313358 AGCTTGCAGCAGCCACTCTGGGG - Intergenic
1012608140 6:101183444-101183466 AAGGTGAAGAAGGCACTTTGTGG + Intergenic
1014037156 6:116779773-116779795 AAGATACTGCTGCCACCTTGTGG - Intergenic
1014825906 6:126048168-126048190 AAGAAGCAACAGGCATTTTGAGG - Intergenic
1014974731 6:127865132-127865154 AATATGCAGCACCCCCTTAGAGG + Intronic
1015966281 6:138697894-138697916 AAGATGCAACAGGCACCGTGGGG + Intergenic
1016832254 6:148445661-148445683 AAGATGCAGCAGCCACTTTGAGG - Intronic
1018204530 6:161424877-161424899 AAGAGACAGCAGCCACGATGTGG + Intronic
1018287665 6:162257998-162258020 AAAACGCAGCAGCCAGTATGGGG - Intronic
1018651455 6:165994956-165994978 AGGATGCAGGAGCCAGGTTGAGG - Intergenic
1023053345 7:36272432-36272454 AAGATGCAGTGGCAAGTTTGTGG - Intronic
1024657411 7:51463198-51463220 AAGGTGGAGCATCTACTTTGAGG - Intergenic
1024750441 7:52458975-52458997 AAGAAGCAGCAGCCATCTTAGGG - Intergenic
1025254450 7:57374079-57374101 AGGTGGCAGAAGCCACTTTGAGG + Intergenic
1026545325 7:71317144-71317166 AAGAAACAGCAGGCACGTTGGGG - Intronic
1027443552 7:78246069-78246091 AAGATGCAGCAACCACTGGGAGG - Intronic
1030613174 7:111710809-111710831 AAGATGAAGCAGGTACATTGAGG - Intergenic
1031836769 7:126688937-126688959 AAGATGCAGTTGCTCCTTTGCGG - Intronic
1032952534 7:136931396-136931418 AAGCTGCTTCTGCCACTTTGAGG - Intronic
1034702194 7:153106043-153106065 AAGATTGAGAAGGCACTTTGTGG - Intergenic
1035386622 7:158477198-158477220 AAGATGTCCCAGCCACCTTGTGG - Intronic
1037014254 8:13882822-13882844 AAGATGGAACAGCCACAGTGAGG + Intergenic
1041429409 8:57762119-57762141 ATGATGCAGTAGACACTCTGAGG + Intergenic
1042054986 8:64755007-64755029 AAGTTCCACCAGCAACTTTGGGG + Intronic
1042590308 8:70391804-70391826 AAGCTGTAACAGCCATTTTGGGG + Intronic
1042608565 8:70572713-70572735 AAAATGCAGGAGGCATTTTGTGG + Intergenic
1042653473 8:71069042-71069064 AACATGGTGCAGCCCCTTTGGGG + Intergenic
1043637531 8:82405065-82405087 GAGAAGCAGGAGCTACTTTGAGG + Intergenic
1045424808 8:102055018-102055040 GAGATGGTGCAGCCACTGTGAGG + Intronic
1045591398 8:103602467-103602489 AAGACGCTGGAGCCTCTTTGAGG - Intronic
1045601405 8:103721946-103721968 AAGATGGAGGAGCCGTTTTGGGG + Intronic
1045832818 8:106484727-106484749 AAAATGGTACAGCCACTTTGGGG + Intronic
1046277843 8:111986058-111986080 AAGAGGCAGCAGCCACATTGAGG + Intergenic
1047204491 8:122792554-122792576 AAAATGATGCATCCACTTTGGGG - Intronic
1047570083 8:126088292-126088314 ATGAAACAGCAGTCACTTTGGGG + Intergenic
1050127138 9:2368512-2368534 ATGATGCATCAGCCAATTTGGGG - Intergenic
1057935149 9:99231886-99231908 GAGATGCTGCAGCCACATGGGGG + Intergenic
1058107491 9:100989205-100989227 GAGAGGCAGCAGACACTTGGAGG + Intergenic
1061761815 9:132856746-132856768 GAGCTGCGGCAGCCACTTCGTGG + Intronic
1062303875 9:135890979-135891001 AAGCTGCAGCAGGCACACTGGGG + Intronic
1062671485 9:137712380-137712402 AAGATGGGGCAGCCACCGTGGGG - Intronic
1187927129 X:24260716-24260738 AAGCTGGGGCAGCCACTTGGAGG + Intergenic
1189257360 X:39650915-39650937 AAGCTGCAGCAGCGTCTCTGTGG + Intergenic
1192232828 X:69277837-69277859 CAGCAGCAGCAGCAACTTTGGGG + Intergenic
1195674458 X:107497281-107497303 AGGAAGAAGCAGCCTCTTTGTGG - Intergenic
1196399863 X:115303307-115303329 AAGATGCAGAAGCAACTCTGAGG + Exonic
1196414310 X:115454702-115454724 AACCTGCAGCAGCCACTGTCAGG - Intergenic
1198574715 X:137997587-137997609 AAGATGCTGCTGCTGCTTTGTGG - Intergenic
1200775175 Y:7164095-7164117 CAGGTGCAGCAGTAACTTTGAGG + Intergenic
1200966151 Y:9040435-9040457 GAGATGCAGCAGCCAGTCTAAGG - Intergenic
1201394731 Y:13536500-13536522 AAAAGGCAGCAGCCACATTAGGG - Intergenic