ID: 1016832262

View in Genome Browser
Species Human (GRCh38)
Location 6:148445702-148445724
Sequence CAGGGCGAAGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016832254_1016832262 18 Left 1016832254 6:148445661-148445683 CCTCAAAGTGGCTGCTGCATCTT 0: 1
1: 0
2: 4
3: 24
4: 197
Right 1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG No data
1016832252_1016832262 28 Left 1016832252 6:148445651-148445673 CCCGTCATAGCCTCAAAGTGGCT 0: 1
1: 0
2: 1
3: 19
4: 211
Right 1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG No data
1016832253_1016832262 27 Left 1016832253 6:148445652-148445674 CCGTCATAGCCTCAAAGTGGCTG 0: 1
1: 0
2: 4
3: 35
4: 214
Right 1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016832262 Original CRISPR CAGGGCGAAGAGAGGGAAGA AGG Intronic
No off target data available for this crispr