ID: 1016838063

View in Genome Browser
Species Human (GRCh38)
Location 6:148498955-148498977
Sequence TCTAATAAGCAGGCTTAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1240
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 1203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016838063 Original CRISPR TCTAATAAGCAGGCTTAGGT TGG (reversed) Intronic
900355151 1:2257848-2257870 GCTACTCAGCAGGCTAAGGTAGG - Intronic
900925199 1:5701218-5701240 TCTACTCAGGAGGCTTAGGCAGG + Intergenic
901715979 1:11154735-11154757 TCTACTCAGGAGGCTGAGGTGGG + Intronic
901897418 1:12326447-12326469 GCTACTCAGGAGGCTTAGGTGGG - Intronic
901961497 1:12829759-12829781 GCTAATAGGGAGGCTGAGGTAGG + Intronic
902285370 1:15404979-15405001 ACTACTAAGGAGGCTGAGGTGGG + Intergenic
902370201 1:16001696-16001718 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
902401173 1:16157677-16157699 TCTACTAAGGAGGCTAAGGCAGG + Intergenic
902464811 1:16609965-16609987 GCTACTAAGGAGGCTGAGGTGGG + Intronic
902865059 1:19272590-19272612 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
902906459 1:19561763-19561785 GCTACTAAGGAGGCTAAGGTGGG - Intergenic
903155988 1:21443723-21443745 GCTACTAAGGAGGCTGAGGTGGG - Intronic
903590438 1:24451589-24451611 GCTACTAAGGAGGCTAAGGTGGG + Intronic
903626574 1:24735023-24735045 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
903699410 1:25235406-25235428 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
903879008 1:26496003-26496025 ACTACTAAGGAGGCTGAGGTGGG + Intergenic
903928264 1:26847321-26847343 GCTACTAAGGAGGCTGAGGTGGG - Intronic
903981358 1:27190846-27190868 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
904027759 1:27515307-27515329 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
904064406 1:27737738-27737760 GCTACTCAGCAGGCTGAGGTGGG + Intronic
904095192 1:27971480-27971502 GCTAATCAGGAGGCTGAGGTAGG + Exonic
904212166 1:28893191-28893213 CCTACTCAGGAGGCTTAGGTAGG - Intronic
904220853 1:28967715-28967737 TCTACTTAGAAGGCTGAGGTGGG - Intronic
904446336 1:30575764-30575786 GCTACTTAGCAGGCTGAGGTGGG + Intergenic
904581139 1:31545110-31545132 TCTAATTTGCAGGCTTTGGGAGG - Intergenic
904699550 1:32350409-32350431 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
904737436 1:32645388-32645410 TCTACTCAGGAGGCTGAGGTGGG + Intronic
904740857 1:32674837-32674859 GCTAATCAGCAGGCTGAGGCAGG - Intronic
905095665 1:35468335-35468357 AGAAATAAGCAGGCTGAGGTTGG - Intronic
905101499 1:35526964-35526986 GCTACTCAGCAGGCTGAGGTGGG + Intronic
905188087 1:36211247-36211269 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
905459043 1:38109613-38109635 GCTAATCAGAAGGCTGAGGTGGG - Intergenic
905628056 1:39501464-39501486 TCTATTCAGGAGGCTGAGGTAGG - Intronic
905644190 1:39613259-39613281 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
906024979 1:42665736-42665758 TCTACTAGGGAGGCTGAGGTGGG + Intronic
906025844 1:42673104-42673126 CCTACTAAGGAGGCTGAGGTGGG - Intronic
906113897 1:43342873-43342895 GCTAATCAGGAGGCTCAGGTGGG - Intronic
906223059 1:44098079-44098101 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
906359329 1:45139290-45139312 GCTAGTAAGGAGGCTGAGGTGGG - Intronic
907101545 1:51842058-51842080 TCTACTTAGGAGGCTGAGGTTGG + Intronic
907466392 1:54640621-54640643 GCTACTTAGCAGGCTGAGGTGGG - Intergenic
907538980 1:55194872-55194894 TCAAGTAAGCAGGCTTGGCTAGG - Intronic
907864533 1:58386946-58386968 GCTACTCAGCAGGCTGAGGTAGG + Intronic
908197239 1:61757181-61757203 TCTACTCAGGAGGCTAAGGTGGG - Intronic
908307613 1:62839168-62839190 GCTACTTAGGAGGCTTAGGTGGG - Intronic
908760582 1:67508150-67508172 TCTATTCAGGAGGCTGAGGTAGG - Intergenic
908998431 1:70187717-70187739 TCTACTCAGAAGGCTGAGGTGGG + Intronic
909613984 1:77586149-77586171 TCTACTAAGCAGGCTCACATAGG + Intronic
910216633 1:84850473-84850495 TCTACTCAGGAGGCTGAGGTGGG + Intronic
910792113 1:91062581-91062603 TCTAATCAGCAGGCCTAGGGTGG + Intergenic
910868668 1:91811197-91811219 TCTACTCAGGAGGCTGAGGTGGG + Intronic
910928694 1:92421501-92421523 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
910964989 1:92799348-92799370 CCTACTAAGGAGGCTGAGGTGGG + Intergenic
911012161 1:93291991-93292013 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
911249215 1:95556426-95556448 GCTAATTAGGAGGCTGAGGTGGG - Intergenic
911431146 1:97788913-97788935 GCTACTCAGGAGGCTTAGGTAGG - Intronic
911607879 1:99928897-99928919 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
911644721 1:100326144-100326166 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
911740796 1:101384988-101385010 GCTATTCAGCAGGCTGAGGTAGG - Intergenic
911889082 1:103344395-103344417 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
911891230 1:103374563-103374585 TCTCAAAAGCATGCCTAGGTTGG + Intergenic
911909375 1:103613132-103613154 TCTACTTAGGAGGCTGAGGTAGG + Intergenic
912320373 1:108707240-108707262 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
912403689 1:109418425-109418447 GCTATTTTGCAGGCTTAGGTGGG - Intronic
912569630 1:110611908-110611930 GCTACTCAGGAGGCTTAGGTAGG + Intronic
912636016 1:111293968-111293990 GCTAATCAGGAGGCTGAGGTGGG + Intronic
912782616 1:112565897-112565919 GCTACTAGGAAGGCTTAGGTGGG + Intronic
912906123 1:113709122-113709144 GCTAATCAGGAGGCTGAGGTGGG + Intronic
913026407 1:114846572-114846594 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
913248686 1:116892946-116892968 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
913500734 1:119470449-119470471 GCTAATAAGAAGCCTGAGGTAGG - Intergenic
914406514 1:147379491-147379513 GCTAATAAGATGACTTAGGTGGG - Intergenic
914714957 1:150246870-150246892 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
914723358 1:150307467-150307489 TCTACTCAGGAGGCTGAGGTGGG - Intronic
914813999 1:151049662-151049684 GCTATTCAGCAGGCTAAGGTGGG - Intronic
914848464 1:151296132-151296154 GCTAATCAGGAGGCTGAGGTGGG + Intronic
915073439 1:153290785-153290807 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
915438091 1:155924683-155924705 GCTATTCAGCAGGCTGAGGTAGG - Intronic
915499248 1:156303405-156303427 GCTACTAAGGAGGCTAAGGTGGG - Intergenic
916054032 1:161055379-161055401 TCTACTCAGGAGGCTGAGGTAGG + Intronic
916141349 1:161701801-161701823 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
916184990 1:162122617-162122639 GCTAATCAGGAGGCTGAGGTGGG - Intronic
916454867 1:164960565-164960587 TCTGATAACCAGCCTTAGTTTGG + Intergenic
916564275 1:165959480-165959502 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
917245879 1:172999603-172999625 TCTAATAAGCAGGCTCCCATTGG - Intergenic
917334506 1:173913964-173913986 TCTACTCAGGAGGCTGAGGTGGG + Intronic
917522050 1:175756031-175756053 TCTACTCAGCAGGCTGAGATAGG - Intergenic
917571479 1:176270027-176270049 TGTACTCAGGAGGCTTAGGTGGG + Intergenic
917586934 1:176436593-176436615 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
917780009 1:178384554-178384576 GCTAATCAGGAGGCTGAGGTGGG + Intronic
918082146 1:181215939-181215961 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
918971930 1:191431385-191431407 TCTACTGAGAAGGCTGAGGTGGG - Intergenic
919052920 1:192533495-192533517 CCAAAAAAGCAGGCTTTGGTAGG + Intergenic
919637183 1:200014241-200014263 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
919769104 1:201145848-201145870 GCTAATCAGGAGGCTGAGGTGGG + Intronic
919950308 1:202356931-202356953 GCTAATAAGGAGGCTGAGGCAGG - Intronic
920236158 1:204507300-204507322 CCTAGTAAGCATGATTAGGTAGG + Intergenic
920530907 1:206701720-206701742 TCTACTCAGGAGGCTGAGGTGGG + Intronic
920583290 1:207133649-207133671 GCTACTCAGGAGGCTTAGGTGGG + Intronic
920787727 1:209058501-209058523 TCTACTCAGAAGGCTGAGGTGGG + Intergenic
920905812 1:210166452-210166474 GCTACTCAGGAGGCTTAGGTGGG + Intronic
920999425 1:211027490-211027512 GCTACTCAGCAGGCTAAGGTGGG + Intronic
921040474 1:211426456-211426478 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
921107528 1:211997422-211997444 TCTACTCAGGAGGCTGAGGTGGG + Intronic
921366849 1:214382431-214382453 GCTAATCAGGAGGCTGAGGTGGG - Intronic
921385464 1:214564403-214564425 GCTACTTAGCAGGCTGAGGTGGG - Intergenic
921474414 1:215589253-215589275 GCTACTAAGGAGGCTGAGGTGGG - Intronic
921704749 1:218309569-218309591 GCTAATCAGGAGGCTGAGGTGGG + Intronic
921861330 1:220045390-220045412 GCTACTAAGGAGGCTGAGGTGGG + Intronic
921868639 1:220112972-220112994 GCTAATCAGAAGGCTTAGGCAGG - Intronic
922174536 1:223186915-223186937 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
922322379 1:224500113-224500135 GCTACTAAGGAGGCTGAGGTGGG - Intronic
922425609 1:225489835-225489857 GCTACTAAGGAGGCTGAGGTAGG + Exonic
922524046 1:226283839-226283861 TCTACTCAGGAGGCTGAGGTAGG + Intronic
922662901 1:227445744-227445766 GCTACTCAGGAGGCTTAGGTTGG + Intergenic
922904257 1:229162014-229162036 GCTATTTAGCAGGCTTAGGCAGG - Intergenic
922948936 1:229541826-229541848 GCTACTAAGGAGGCTGAGGTGGG + Intronic
923191570 1:231625794-231625816 GCTACTCGGCAGGCTTAGGTGGG - Intronic
923455452 1:234161692-234161714 GCTACTAAGGAGGCTGAGGTGGG + Intronic
923507784 1:234621033-234621055 GCTACTAAGCAGGCTGAGGCAGG + Intergenic
923585954 1:235271241-235271263 GCTACTAAGGAGGCTGAGGTGGG + Intronic
923705890 1:236344647-236344669 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
923923469 1:238596418-238596440 CCTACTCAGGAGGCTTAGGTGGG + Intergenic
924220398 1:241868554-241868576 TCTATTCAGGAGGCTGAGGTGGG + Intronic
924238418 1:242018769-242018791 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
924352539 1:243131378-243131400 GCTACTAAGAAGGCTGAGGTGGG + Intronic
1063007928 10:1992410-1992432 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1063119741 10:3096964-3096986 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1063642423 10:7843217-7843239 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1063683336 10:8211672-8211694 TCTACTAGGGAGGCTGAGGTGGG + Intergenic
1063923923 10:10958730-10958752 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1064112166 10:12548965-12548987 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1064223093 10:13458481-13458503 TTTAAGAAGCAGGGGTAGGTGGG + Intronic
1064239570 10:13613844-13613866 TCTAAAAAGTGGTCTTAGGTAGG - Exonic
1064301640 10:14128213-14128235 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1064393748 10:14963206-14963228 GCTAATCAGGAGGCTGAGGTAGG - Intronic
1065008402 10:21400823-21400845 TCTAATCAGGAGGCTGAGGCAGG - Intergenic
1065012949 10:21435965-21435987 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1065141713 10:22724809-22724831 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1065160667 10:22917693-22917715 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1065179894 10:23114236-23114258 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1065552005 10:26877481-26877503 GCTACTAAGAAGGCTGAGGTGGG - Intergenic
1065908719 10:30282774-30282796 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1065959268 10:30720953-30720975 GCTACTAAGGAGGCTTAGGCAGG + Intergenic
1066004057 10:31131161-31131183 GCTAATAAGGAGGCTGAGGAAGG + Intergenic
1066189083 10:33038847-33038869 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1066390712 10:34975671-34975693 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1066507538 10:36060913-36060935 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1066570892 10:36770470-36770492 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1067108297 10:43380295-43380317 GCTAATCAGGAGGCTGAGGTAGG - Intergenic
1067743491 10:48914659-48914681 TCTAAGATCCAGGCTTATGTTGG - Intronic
1067816761 10:49484167-49484189 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1067857106 10:49803997-49804019 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1067917306 10:50414290-50414312 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1067933704 10:50589579-50589601 GCTATTCAGCAGGCTGAGGTGGG - Intronic
1067940142 10:50648298-50648320 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1068901516 10:62274611-62274633 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1068918130 10:62455070-62455092 TAGAATAAGAAGGCTTTGGTGGG + Intronic
1069257211 10:66347500-66347522 GCTATTCAGGAGGCTTAGGTAGG + Intronic
1069469419 10:68674218-68674240 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1069496694 10:68910512-68910534 ACTACTCAGCAGGCTGAGGTAGG - Intronic
1069561339 10:69432651-69432673 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1069645050 10:69989498-69989520 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1069730164 10:70606116-70606138 GCTACTCAGAAGGCTTAGGTGGG + Intergenic
1069955123 10:72045292-72045314 TCTACTAAGGAGGCTGAGGCAGG - Intergenic
1070126103 10:73623272-73623294 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1070179959 10:74003829-74003851 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1070208161 10:74285567-74285589 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1070236027 10:74627369-74627391 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1070250811 10:74771555-74771577 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1070619956 10:78001745-78001767 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1071473677 10:86006504-86006526 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1071684326 10:87738519-87738541 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1071863868 10:89703862-89703884 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1072047676 10:91673036-91673058 GCTAATCAGGAGGCTAAGGTAGG - Intergenic
1072137065 10:92557061-92557083 GCAAAAAAGGAGGCTTAGGTGGG - Intronic
1072263689 10:93706791-93706813 GCTACTAAGCAGGCTGAGGTGGG - Intergenic
1072327067 10:94309440-94309462 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1072337173 10:94407570-94407592 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1072461330 10:95621429-95621451 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1072558515 10:96545775-96545797 GCTATTGAGCAGGCTGAGGTAGG + Intronic
1072603295 10:96953437-96953459 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1072893591 10:99346717-99346739 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1073159861 10:101383173-101383195 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1073240167 10:102052333-102052355 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1073280292 10:102349035-102349057 GCTACTAAGGAGGCTTAGGTAGG + Intronic
1073342686 10:102757686-102757708 GCTACTAAGGAGGCTAAGGTGGG - Intronic
1073367276 10:102953669-102953691 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1073411696 10:103347800-103347822 GCTATTAAGGAGGCTGAGGTGGG - Intronic
1074136727 10:110633941-110633963 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1074339428 10:112612531-112612553 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1074514867 10:114157293-114157315 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1075039761 10:119098794-119098816 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1075100550 10:119503225-119503247 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1075108377 10:119558826-119558848 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1075463506 10:122634023-122634045 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1076018280 10:127046647-127046669 GCTAATCAGAAGGCTGAGGTAGG + Intronic
1077608848 11:3631257-3631279 GCTAATAGGAAGGCTGAGGTGGG - Intergenic
1078320870 11:10333355-10333377 ACTAATACGGAGGCTGAGGTGGG + Intronic
1079256508 11:18835633-18835655 ACTACTCAGGAGGCTTAGGTGGG - Intergenic
1079357143 11:19739067-19739089 GCTACTCAGCAGGCTAAGGTGGG + Intronic
1079596737 11:22259019-22259041 TCTACTAAGGAGGCTGAGGCAGG + Intronic
1079730062 11:23929168-23929190 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1080168410 11:29269012-29269034 TTTAATAAGAAGGCAGAGGTGGG + Intergenic
1080322829 11:31034030-31034052 GCTACTCAGGAGGCTTAGGTAGG + Intronic
1080367504 11:31592428-31592450 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1080410792 11:32023049-32023071 GCTAATAGGGAGGCTCAGGTGGG + Intronic
1080498515 11:32846044-32846066 ACTACTAGGCGGGCTTAGGTGGG + Intronic
1080689931 11:34548160-34548182 GCTACTCAGAAGGCTTAGGTGGG - Intergenic
1080916191 11:36662832-36662854 GCTATTCAGCAGGCTGAGGTGGG - Intergenic
1081158716 11:39727741-39727763 TTAAACAAGCAGGCTTAGCTAGG - Intergenic
1081274708 11:41134206-41134228 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1081327194 11:41759213-41759235 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1081351991 11:42065673-42065695 TCTATTAATCAGGCTAAGCTAGG + Intergenic
1081714459 11:45238662-45238684 GCTACTAAGGAGGCTAAGGTGGG + Intergenic
1081973258 11:47214657-47214679 TCTACTTAGGAGGCTGAGGTGGG + Intronic
1082057144 11:47827600-47827622 TCTACTCAGAAGGCTGAGGTGGG + Intronic
1082084862 11:48041734-48041756 TCTACTCAGGAGGCTAAGGTGGG - Intronic
1082259763 11:50069656-50069678 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1083370512 11:62175350-62175372 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1083432970 11:62624324-62624346 GCTATTAAGGAGGCTGAGGTGGG + Intergenic
1083474303 11:62906075-62906097 TCTGATAAGCAGGCTCAGGCGGG + Intergenic
1083546892 11:63555578-63555600 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1083805542 11:65071629-65071651 TCTAAGATTCAGGCTTAAGTGGG + Intronic
1083977817 11:66138201-66138223 TCTACTAAGAAGGCTGAGGCAGG - Intronic
1084027375 11:66459985-66460007 GCTAATCAGGAGGCTGAGGTAGG + Intronic
1084382653 11:68823136-68823158 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1084471852 11:69366833-69366855 CCTACTAAGGAGGCTGAGGTGGG - Intronic
1084797945 11:71520726-71520748 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1084867877 11:72074625-72074647 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1085169067 11:74432776-74432798 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1085610790 11:77946647-77946669 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1085802262 11:79601489-79601511 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1087044277 11:93831169-93831191 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1087084293 11:94200790-94200812 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1087431053 11:98055891-98055913 TCTAATCAGGAGGGTGAGGTGGG - Intergenic
1087783994 11:102333452-102333474 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1087893669 11:103563850-103563872 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1088292673 11:108258006-108258028 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1088318621 11:108532287-108532309 GCTACTCAGGAGGCTTAGGTAGG - Intronic
1088484690 11:110329264-110329286 GCTACTAGGGAGGCTTAGGTGGG - Intergenic
1088546807 11:110967497-110967519 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1089062942 11:115641146-115641168 TGTAGTAAGCGGGATTAGGTGGG + Intergenic
1089067579 11:115673540-115673562 TCTATTCAGGAGGCTGAGGTGGG + Intergenic
1089175050 11:116542403-116542425 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1089235891 11:117024787-117024809 GCTACTTAGCAGGCTGAGGTGGG + Intronic
1089275060 11:117329206-117329228 TCTACTAAGGAGACTGAGGTGGG - Intronic
1089999609 11:122944083-122944105 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1090024192 11:123153792-123153814 GCTACTAAGAAGGCTGAGGTGGG - Intronic
1090532484 11:127605371-127605393 TCTACTCAGGAGGCTGAGGTTGG - Intergenic
1090958968 11:131539042-131539064 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1091083259 11:132693355-132693377 TAAAATAATCAGGCTAAGGTAGG - Intronic
1091423451 12:364363-364385 TCTACTCAGGAGGCTGAGGTAGG + Intronic
1091435905 12:472731-472753 TAAAATTAGCAGGCATAGGTCGG - Intronic
1092221670 12:6717962-6717984 TCTAATCAGGAGGCTGAGGTGGG - Intergenic
1092300031 12:7238937-7238959 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1092343210 12:7693839-7693861 TCTACTCGGCAGGCTGAGGTGGG + Intronic
1092530328 12:9338798-9338820 GCTAATCAGTAGGCTGAGGTGGG - Intergenic
1092759956 12:11800820-11800842 GCTAATAGGGAGGCTTAGTTGGG + Intronic
1092786377 12:12030618-12030640 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1092843461 12:12563885-12563907 ACTGATAAGCAGGTTTGGGTGGG + Intergenic
1093724788 12:22491758-22491780 GCTACTAAGGAGGCTAAGGTGGG + Intronic
1093739689 12:22670211-22670233 TTTAATCATCAGGCTTAGGTAGG - Intronic
1093947175 12:25122343-25122365 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1094080722 12:26532490-26532512 GCTACTTAGCAGGCTGAGGTGGG - Intronic
1094730671 12:33171018-33171040 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1094806192 12:34095210-34095232 TCTAATAATAAGGATTTGGTGGG - Intergenic
1095091932 12:38115676-38115698 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1095258276 12:40067311-40067333 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1096014443 12:48256190-48256212 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1096076461 12:48808788-48808810 GCTACTAGGGAGGCTTAGGTGGG + Intergenic
1096128380 12:49136958-49136980 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1096132585 12:49172012-49172034 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1096165789 12:49422798-49422820 GCTACTCAGGAGGCTTAGGTAGG + Intronic
1096429788 12:51533300-51533322 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1096731134 12:53613630-53613652 GCTACTCAGGAGGCTTAGGTAGG - Intronic
1097117687 12:56710198-56710220 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1097692555 12:62747061-62747083 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1097700380 12:62814189-62814211 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1097765846 12:63525843-63525865 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1097828859 12:64202297-64202319 TCAAATTAGAAGGCTGAGGTGGG + Intronic
1097847684 12:64383203-64383225 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1098022697 12:66172156-66172178 TCTGAAAAGGAGCCTTAGGTAGG - Intergenic
1098270713 12:68767403-68767425 TCTACTCAGGAGGCTGAGGTGGG + Exonic
1098417493 12:70252296-70252318 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1099430022 12:82571995-82572017 GCTACTTAGGAGGCTTAGGTGGG + Intergenic
1099919869 12:88944023-88944045 TCTACTCAGGAGGCCTAGGTGGG + Intergenic
1100181700 12:92093181-92093203 GCTAATAGGGAGGCTGAGGTGGG - Intronic
1100318125 12:93464526-93464548 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1100478850 12:94958905-94958927 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1100485015 12:95016920-95016942 ACTAATCAGGAGGCTGAGGTGGG + Intergenic
1100982902 12:100176735-100176757 TCTACTCAGCAGGCTGAGGTAGG - Intergenic
1101482299 12:105109756-105109778 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1101608440 12:106268225-106268247 TCTACTAGGGAGGCTGAGGTAGG + Intronic
1101804814 12:108054501-108054523 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1102066872 12:109984298-109984320 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1102072831 12:110035802-110035824 ACTAGTCAGGAGGCTTAGGTGGG + Intronic
1102133983 12:110557384-110557406 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1102293082 12:111716742-111716764 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1102378538 12:112443762-112443784 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1102381873 12:112473992-112474014 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1102510374 12:113411070-113411092 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1102684504 12:114714186-114714208 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1102900173 12:116630497-116630519 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1103147125 12:118604516-118604538 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1103757313 12:123219012-123219034 TCTACTAGGGAGGCTGAGGTGGG - Intronic
1103947788 12:124536186-124536208 GCTACTTAGCAGGCTTAGGTGGG - Intronic
1103971121 12:124673327-124673349 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1104431550 12:128720470-128720492 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1104696615 12:130868908-130868930 GCTACTAAGCAGGCTGAGGTGGG + Intergenic
1104795667 12:131515661-131515683 GCTACTTAGCAGGCTGAGGTGGG - Intergenic
1105301973 13:19143562-19143584 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1105312065 13:19220798-19220820 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1105329147 13:19398730-19398752 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1105370083 13:19794616-19794638 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1105862710 13:24430540-24430562 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1105920007 13:24954298-24954320 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1105958669 13:25308412-25308434 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1106011672 13:25830118-25830140 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1106514092 13:30438091-30438113 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1106804521 13:33292487-33292509 TCTAATTGGAAGGCTGAGGTAGG + Intronic
1106922370 13:34577230-34577252 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1107013032 13:35686437-35686459 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1107037372 13:35915591-35915613 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1107088982 13:36455751-36455773 TCTAATAAGCAGCTTTAAGGAGG + Intergenic
1107137614 13:36961301-36961323 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1107878202 13:44809035-44809057 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1107902224 13:45028642-45028664 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1108203844 13:48068196-48068218 CCTAATAAACAGGCATAGGTTGG - Intronic
1108214594 13:48172079-48172101 GCTAGTTAGCAGGCTGAGGTGGG - Intergenic
1108227770 13:48306291-48306313 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1108235689 13:48402487-48402509 TCTACTAAGGAGGCTGAGGTGGG - Intronic
1108280616 13:48857367-48857389 CCTACTCAGCAGGCTGAGGTAGG + Intergenic
1109237373 13:59841480-59841502 GCTAATATGGAGGCTGAGGTGGG + Intronic
1109746032 13:66623548-66623570 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1110021207 13:70476235-70476257 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110200273 13:72841656-72841678 CCTATTAAGGAGGCTGAGGTGGG + Intronic
1110315249 13:74099233-74099255 TCTACTAGGGAGGCTGAGGTGGG + Intronic
1110526872 13:76548350-76548372 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1110840400 13:80135482-80135504 TCTACTAAGGAGGCTGAGGCAGG + Intergenic
1111176080 13:84598120-84598142 TCTACTCAGAAGGCTGAGGTGGG - Intergenic
1112143592 13:96673212-96673234 TCTCATAAGGAGGCTTATGATGG + Intronic
1112408765 13:99144071-99144093 ACTAATGAGAAGGCTGAGGTGGG + Intergenic
1112544619 13:100354162-100354184 GCTACTAAGAAGGCTGAGGTGGG + Intronic
1112653223 13:101420743-101420765 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1112939935 13:104848782-104848804 ACTATTCAGGAGGCTTAGGTGGG + Intergenic
1113642305 13:111966290-111966312 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1114322510 14:21559010-21559032 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1114403671 14:22433777-22433799 TCTACTCAGAAGGCTGAGGTGGG + Intergenic
1114430910 14:22659707-22659729 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1114632750 14:24170118-24170140 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1115025715 14:28743068-28743090 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
1115183383 14:30655997-30656019 CCTACTCAGGAGGCTTAGGTGGG + Intronic
1115248032 14:31316797-31316819 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1115687917 14:35815838-35815860 GCTACTAAGCAGGCTGAGGTGGG - Intergenic
1115854969 14:37621495-37621517 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1116196581 14:41735377-41735399 GCTAGTCAGCAGGCTGAGGTAGG - Intronic
1116462228 14:45190977-45190999 GCTACTAAGAAGGCTGAGGTAGG - Intronic
1116852639 14:49923877-49923899 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1117132126 14:52696592-52696614 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1117141325 14:52793192-52793214 TCTACTCAGGAGGCTGAGGTAGG + Intergenic
1117361982 14:54984381-54984403 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1117766400 14:59087680-59087702 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1118301041 14:64616293-64616315 ACTAATGAGGAGGCTGAGGTGGG - Intergenic
1118349481 14:64963458-64963480 CCTAAGTAGCAGGCTTAGGGAGG - Intronic
1118550404 14:66943879-66943901 CCTAATAAACAGGCATAGATGGG + Intronic
1118690779 14:68337881-68337903 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1118882168 14:69838643-69838665 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1119214498 14:72858194-72858216 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1119290966 14:73494660-73494682 TCTACTAAGGAGGCTGAGATGGG - Intronic
1119462466 14:74819384-74819406 GCTAATAAGGAGGCTGAGGCAGG - Intronic
1119500364 14:75121737-75121759 GCTAATCAGGAGGCTAAGGTGGG + Intronic
1119713414 14:76840198-76840220 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1119824870 14:77649242-77649264 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1119830833 14:77700981-77701003 GCTACTAGGCAGGCTGAGGTGGG + Intronic
1119834514 14:77736249-77736271 TTTAAAAAGCAGCTTTAGGTCGG + Intronic
1120105482 14:80489426-80489448 TCTAATGAGCACTCTGAGGTAGG + Intronic
1120944285 14:89979419-89979441 GCTACTAAGCAGGCTGAGGCAGG - Intronic
1121086748 14:91152283-91152305 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1121136894 14:91507207-91507229 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1121243364 14:92445948-92445970 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1121333420 14:93062316-93062338 GCTACTAAGAAGGCTGAGGTGGG + Intronic
1122216954 14:100211116-100211138 GCTACTAAGGAGGCTCAGGTGGG + Intergenic
1122649341 14:103217079-103217101 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1122674597 14:103400781-103400803 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1123391017 15:19872586-19872608 TCTATTCAGGAGGCTGAGGTAGG - Intergenic
1123413304 15:20076963-20076985 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1123434810 15:20247401-20247423 TCTACTCAGCAGGCTGAGGCAGG + Intergenic
1123522646 15:21084074-21084096 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1124350193 15:28949578-28949600 TCTAATTGGGAGGCTGAGGTGGG - Intronic
1124396666 15:29308262-29308284 GCTAATCAGCAGGCTGAGGCAGG + Intronic
1124562600 15:30789108-30789130 GCTAGTCAGCAGGCTGAGGTGGG - Intergenic
1124961213 15:34397062-34397084 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1124977843 15:34543283-34543305 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1125042480 15:35207156-35207178 TCTACTTAGGAGGCTGAGGTGGG - Intergenic
1125315793 15:38429802-38429824 ACTAATCAGGAGGCTGAGGTGGG + Intergenic
1125561823 15:40639660-40639682 GCTAATTGGCAGGCTGAGGTTGG + Intronic
1125620003 15:41052025-41052047 TCTACTAGGGAGGCTGAGGTGGG + Intronic
1125696120 15:41638800-41638822 GCTAATAGGGAGGCTGAGGTAGG - Intronic
1125805141 15:42487374-42487396 GCTACTAAGAAGGCTGAGGTGGG + Intronic
1125936926 15:43645165-43645187 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1125963533 15:43853300-43853322 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1126077078 15:44921799-44921821 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1126079613 15:44946632-44946654 TCTACTTAGGAGGCTGAGGTGGG + Intergenic
1126113989 15:45192477-45192499 GCTATTCAGCAGGCTGAGGTGGG - Intronic
1126131198 15:45343298-45343320 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1126961265 15:53997912-53997934 TCTACTAGGGAGGCTGAGGTGGG - Intergenic
1127237823 15:57074617-57074639 ACTAATCAGGAGGCTAAGGTGGG - Intronic
1127975787 15:63996329-63996351 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1128336534 15:66789545-66789567 GCTACTTAGCAGGCTGAGGTGGG + Intergenic
1128365988 15:67003415-67003437 ACTACTCAGGAGGCTTAGGTGGG + Intergenic
1128423051 15:67512911-67512933 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1128657837 15:69475502-69475524 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1129121955 15:73403618-73403640 GCTACTCAGCAGGCTAAGGTGGG + Intergenic
1129354691 15:74981998-74982020 TCTACTCAGGAGGCTGAGGTAGG + Intronic
1129800750 15:78412234-78412256 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1129826201 15:78636693-78636715 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1130110000 15:80956076-80956098 ACTACTCAGCAGGCTGAGGTGGG + Intronic
1130409088 15:83629706-83629728 GCTACTTAGGAGGCTTAGGTGGG + Intergenic
1130538081 15:84801211-84801233 TCTATTCAGGAGGCTGAGGTGGG + Intronic
1131002955 15:88953067-88953089 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1131036222 15:89223937-89223959 TCTACTCAGGAGGCTGAGGTAGG + Intergenic
1131562921 15:93459866-93459888 TCTAAGAAGCATACTCAGGTTGG + Intergenic
1131660290 15:94506822-94506844 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1131685775 15:94766166-94766188 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1131689880 15:94815172-94815194 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1131780176 15:95847540-95847562 GCTACTAGGCAGGCTGAGGTAGG - Intergenic
1132774726 16:1586816-1586838 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1133105284 16:3503700-3503722 GCTATTCAGCAGGCTGAGGTGGG - Intronic
1133252560 16:4493143-4493165 TCCACTTAGGAGGCTTAGGTGGG - Intronic
1133311498 16:4849702-4849724 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1133710941 16:8400679-8400701 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1133893863 16:9906952-9906974 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1133949823 16:10381909-10381931 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1133964453 16:10520187-10520209 ACTACTCAGCAGGCTGAGGTGGG - Intergenic
1134078622 16:11309390-11309412 TCTATTCAGGAGGCTGAGGTGGG + Intronic
1134259144 16:12636870-12636892 TCTATTCAGGAGGCTGAGGTGGG + Intergenic
1134816460 16:17210004-17210026 GCTACTCAGCAGGCTAAGGTAGG - Intronic
1135052362 16:19203383-19203405 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1135085422 16:19471200-19471222 ACTACTCAGCAGGCTGAGGTGGG - Intronic
1135335270 16:21596499-21596521 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1135596762 16:23750370-23750392 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1135750244 16:25052746-25052768 TCTACTTGGCAGGCTGAGGTGGG - Intergenic
1135990998 16:27218733-27218755 GCTAGTAAGGAGGCTGAGGTGGG + Intronic
1136177840 16:28530516-28530538 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1136244757 16:28968233-28968255 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1137043002 16:35630929-35630951 TCTACTAAGGAGGCTGAGGTGGG - Intergenic
1137630906 16:49943899-49943921 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1137784339 16:51125553-51125575 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1137881793 16:52056890-52056912 TCTACTGAGCAGGCTTGTGTGGG + Intronic
1138052009 16:53788489-53788511 TCTACTAAGGAGGCTGAGGCAGG + Intronic
1139522917 16:67495431-67495453 GCTATTAGGGAGGCTTAGGTGGG + Intergenic
1139533163 16:67553818-67553840 TCTACTCAGCAGGCTGAGGCAGG - Intergenic
1139591997 16:67938226-67938248 TCTACTAGGCAGGCTGAGGTGGG - Intergenic
1139629711 16:68222192-68222214 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1139686482 16:68607829-68607851 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1139701198 16:68709185-68709207 GCTATTCAGCAGGCTGAGGTGGG - Intronic
1139730058 16:68936070-68936092 ACTATTTAGGAGGCTTAGGTGGG + Intronic
1139743276 16:69053951-69053973 GCTAATCAGGAGGCTGAGGTAGG + Intronic
1139825172 16:69751417-69751439 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140326968 16:74013810-74013832 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1140484510 16:75283083-75283105 TCTAAAAAGCAGGTTTTGGGGGG - Intergenic
1140843469 16:78864377-78864399 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1141474498 16:84263572-84263594 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1142510757 17:391347-391369 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1142518187 17:446942-446964 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1142783922 17:2204849-2204871 GCTAATCAGGAGGCTTAGGAAGG + Intronic
1142802249 17:2353651-2353673 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1143709114 17:8721645-8721667 GCTAGTAAGGAGGCTGAGGTGGG + Intergenic
1143743752 17:8974335-8974357 ACTACTAAGCATGCTGAGGTGGG + Intergenic
1143897942 17:10151654-10151676 GCTATTCAGGAGGCTTAGGTGGG - Intronic
1144035954 17:11366257-11366279 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1144799782 17:17917841-17917863 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1145026271 17:19470108-19470130 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1145037302 17:19550425-19550447 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1145245177 17:21264389-21264411 TCTATTCAGGAGGCTGAGGTAGG - Intergenic
1145843833 17:28020164-28020186 GCTAATAAGGAGGCTAAGGCTGG - Intergenic
1145948343 17:28795254-28795276 TCTACTTGGCAGGCTGAGGTGGG - Intronic
1145950871 17:28815853-28815875 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1146050969 17:29553169-29553191 GCTACTAAGGAGGCTTAGGCAGG + Intergenic
1146120830 17:30192742-30192764 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1146144228 17:30397624-30397646 TCTACTCAGGAGGCTAAGGTGGG + Intronic
1146353642 17:32116536-32116558 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1146409879 17:32573629-32573651 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1146711693 17:35047697-35047719 GCTAATCAGAAGGCTGAGGTTGG - Intronic
1146959322 17:36959329-36959351 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1147012587 17:37463082-37463104 TGTAATAAGGAGGCTGAGGTGGG - Intronic
1147138855 17:38450517-38450539 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1148017768 17:44534380-44534402 GCTATTAAGGAGGCTGAGGTGGG + Intergenic
1148145004 17:45358635-45358657 TCTACTCAAAAGGCTTAGGTGGG + Intergenic
1148247984 17:46048017-46048039 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1148596409 17:48859488-48859510 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1148715599 17:49713616-49713638 GCTACTGAGGAGGCTTAGGTGGG - Intronic
1149492427 17:57094720-57094742 GCTACTGAGCAGGCTGAGGTGGG - Intronic
1149547284 17:57513083-57513105 GCTACTCAGGAGGCTTAGGTAGG - Intronic
1149736286 17:58996655-58996677 CCTACTCAGGAGGCTTAGGTGGG + Intronic
1149803434 17:59591978-59592000 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1149913175 17:60584728-60584750 ACTACTCAGCAGGCTGAGGTGGG + Intronic
1149924935 17:60693524-60693546 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1150111660 17:62505801-62505823 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1150192955 17:63262434-63262456 GCTACTAAGAAGGCTGAGGTGGG - Intronic
1150297277 17:64019271-64019293 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1150347887 17:64418589-64418611 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1150348146 17:64420678-64420700 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1150718330 17:67591819-67591841 GCTACTAAGAAGGCTGAGGTGGG - Intronic
1150771099 17:68041612-68041634 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1150914285 17:69421332-69421354 TCTGTTCAGAAGGCTTAGGTAGG - Intronic
1151204104 17:72492770-72492792 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1151295851 17:73185617-73185639 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1151638294 17:75368654-75368676 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1151795523 17:76342603-76342625 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1152590699 17:81210456-81210478 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1152712664 17:81881359-81881381 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1153031476 18:717510-717532 ACTACTAAGGAGGCTGAGGTGGG - Intergenic
1153054409 18:931847-931869 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1153538170 18:6125538-6125560 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1153769635 18:8405049-8405071 GCTAATTAGGAGGCTGAGGTGGG + Intronic
1153787808 18:8550549-8550571 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1154254613 18:12771618-12771640 TCTAAGAAGCACACTGAGGTAGG + Intergenic
1154361294 18:13663702-13663724 GCTACTCAGCAGGCTGAGGTGGG + Exonic
1155207314 18:23571408-23571430 TGTAATAACCAGGCTGAGGCGGG + Intronic
1155407789 18:25509048-25509070 TCTAATAAGTAAGCTTAGCAAGG + Intergenic
1155455184 18:26004664-26004686 TTTAATAAGCAGTTTTAGGGAGG - Intergenic
1155474340 18:26223401-26223423 TCTAATTGGGAGGCTGAGGTAGG - Intergenic
1155483846 18:26319080-26319102 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1155969862 18:32072087-32072109 GCTACTAAGGAGGCTGAGGTTGG + Exonic
1156342803 18:36226996-36227018 ACTACTCAGGAGGCTTAGGTGGG - Intronic
1156433882 18:37105377-37105399 GCTAATAAGGAGGCTGAGATGGG + Intronic
1156876990 18:42026565-42026587 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1156970724 18:43151333-43151355 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1157232178 18:45927855-45927877 TCTAAGAAGCTTTCTTAGGTTGG - Intronic
1157343278 18:46799656-46799678 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1157377361 18:47178649-47178671 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1157890796 18:51415731-51415753 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1157962671 18:52174007-52174029 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1158561826 18:58520902-58520924 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1159172909 18:64796162-64796184 TCTAATAGGCTGGTTTAGTTTGG + Intergenic
1159759793 18:72409741-72409763 GCTACTAAGAAGGCTGAGGTGGG + Intergenic
1161368593 19:3895961-3895983 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1161516000 19:4696985-4697007 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1161742792 19:6034180-6034202 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1161754193 19:6119591-6119613 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1162114331 19:8419380-8419402 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1162296054 19:9814396-9814418 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1162446881 19:10728833-10728855 GCTACTTAGCAGGCTAAGGTGGG + Intronic
1162531925 19:11241132-11241154 GCTACTCAGGAGGCTTAGGTAGG + Intronic
1162541878 19:11301687-11301709 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1162581960 19:11536837-11536859 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1162815690 19:13192912-13192934 GCTACTAAGTAGGCTCAGGTGGG + Intergenic
1163097986 19:15074324-15074346 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1163137053 19:15319500-15319522 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1163388041 19:17012128-17012150 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1163478046 19:17538509-17538531 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1163984697 19:20934663-20934685 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1165538302 19:36468800-36468822 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1166085062 19:40468985-40469007 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1166170099 19:41022221-41022243 ACTAATCAGGAGGCTGAGGTGGG - Intergenic
1166521247 19:43481680-43481702 GCTAATTAGGAGGCTGAGGTGGG + Intronic
1166807892 19:45497839-45497861 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1166963017 19:46510765-46510787 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1167136576 19:47619782-47619804 TCTAATCTGGAGGCTGAGGTAGG + Intronic
1167453546 19:49586191-49586213 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1168073868 19:53968261-53968283 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1168082026 19:54017120-54017142 GCTATTCAGCAGGCTGAGGTGGG - Intergenic
1168341919 19:55629379-55629401 GCTACTTAGCAGGCTGAGGTGGG + Intergenic
1168418921 19:56188087-56188109 GCTACTCAGCAGGCTCAGGTGGG - Intergenic
1168680835 19:58314513-58314535 GCTAATCAGGAGGCTGAGGTGGG + Intronic
925248933 2:2412378-2412400 GCTACTAAGGAGGCTAAGGTGGG + Intergenic
925320971 2:2968052-2968074 GCTACTAAGAAGGCTGAGGTGGG + Intergenic
925669482 2:6295743-6295765 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
925709326 2:6723043-6723065 GCTACTCAGCAGGCTGAGGTAGG - Intergenic
926001081 2:9333201-9333223 TCTAATAAACTGGCTAAAGTTGG + Intronic
926015787 2:9450261-9450283 GCTAATCAGGAGGCTGAGGTAGG - Intronic
927692371 2:25217004-25217026 GCTACTAAGGAGGCTTAGGCGGG + Intergenic
927700782 2:25267461-25267483 GCTACTCAGGAGGCTTAGGTGGG + Intronic
927818027 2:26237513-26237535 GCTACTCAGGAGGCTTAGGTGGG + Intronic
927884867 2:26712201-26712223 TCTCAGAAACAGGCTGAGGTGGG + Intronic
928120977 2:28583295-28583317 GCTACTAAGGAGGCTGAGGTGGG - Intronic
928751856 2:34479937-34479959 CCTAATCAGAAGGCTGAGGTGGG - Intergenic
928949892 2:36805190-36805212 TCTACTCAGGAGGCTGAGGTGGG + Intronic
928959225 2:36906345-36906367 GCTACTAGGGAGGCTTAGGTGGG + Intronic
929101538 2:38319485-38319507 GCTACTCAGCAGGCTGAGGTAGG + Intronic
929198422 2:39210097-39210119 ACTACTCAGCAGGCTGAGGTGGG - Intronic
929298207 2:40271976-40271998 GCTACTCAGCAGGCTAAGGTGGG - Intronic
929310390 2:40417618-40417640 GCTACTAAGGAGGCTGAGGTGGG - Intronic
929518436 2:42625633-42625655 GCTACTAAGGAGGCTGAGGTAGG + Intronic
929546459 2:42858016-42858038 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
929683392 2:44013579-44013601 GCTACTAGGCAGGCTGAGGTGGG - Intergenic
930157221 2:48118120-48118142 TCTAATCAGGAGGCTGAGGTGGG + Intergenic
930591736 2:53335541-53335563 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
930800642 2:55439245-55439267 GCTATTCAGGAGGCTTAGGTGGG - Intergenic
931358195 2:61555345-61555367 GCTAATCGGCAGGCTGAGGTGGG + Intergenic
931568160 2:63638675-63638697 GCTAATCAGGAGGCTGAGGTGGG + Intronic
931606720 2:64060203-64060225 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
932008525 2:67952374-67952396 GCTAATCAGGAGGCTAAGGTGGG - Intergenic
932041721 2:68306188-68306210 GCTACTCAGCAGGCTGAGGTGGG + Intronic
932202939 2:69848594-69848616 GCTACTCAGCAGGCTGAGGTGGG + Intronic
932555798 2:72824275-72824297 GCTACTCAGGAGGCTTAGGTGGG + Intronic
932653923 2:73591054-73591076 GCTACTCAGAAGGCTTAGGTGGG - Intronic
932695691 2:73954230-73954252 GCTACTCAGCAGGCTGAGGTGGG + Intronic
932847810 2:75153194-75153216 TCTTATAAGAAGTCTTAGGCTGG - Intronic
933162682 2:79043685-79043707 GCTAATAAGAAGGCTGAGGTGGG + Intergenic
933174585 2:79160680-79160702 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
933338217 2:80987124-80987146 TTTAATAAGGAGGCCCAGGTAGG - Intergenic
933681574 2:85106359-85106381 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
933829904 2:86198450-86198472 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
933844542 2:86314802-86314824 GCTACTCAGCAGGCTGAGGTGGG - Intronic
933890926 2:86769047-86769069 GCTACTGAGCAGGCTGAGGTGGG - Intronic
933945023 2:87278672-87278694 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
934017696 2:87906805-87906827 GCTATTCAGGAGGCTTAGGTGGG + Intergenic
934033105 2:88065393-88065415 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
934121673 2:88846152-88846174 TGTAATAACCAGTCTGAGGTGGG + Intergenic
934727309 2:96631932-96631954 GCTACTAAGGAGGCTAAGGTGGG + Intronic
935001566 2:99022213-99022235 GCTACTCAGCAGGCTGAGGTGGG + Intronic
935053005 2:99540025-99540047 TCTACTAGGGAGGCTGAGGTAGG - Intergenic
935910806 2:107894389-107894411 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
935968931 2:108511228-108511250 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
935982111 2:108637965-108637987 GCTACTAAGGAGGCTGAGGTAGG - Intronic
936006101 2:108890354-108890376 GCTACTAAGGAGGCTGAGGTTGG - Intergenic
936132592 2:109859429-109859451 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
936212105 2:110512056-110512078 GCTACTCAGCAGGCTGAGGTAGG - Intergenic
936335184 2:111582918-111582940 GCTAATCAGGAGGCTGAGGTAGG - Intergenic
936421245 2:112366618-112366640 GCTACTCAGCAGGCTGAGGTAGG - Intergenic
936445868 2:112594731-112594753 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
936467568 2:112766854-112766876 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
936594967 2:113839175-113839197 ACTACTTAGCAGGCTGAGGTGGG - Intergenic
937485001 2:122306388-122306410 GCTACTCAGAAGGCTTAGGTGGG + Intergenic
938044853 2:128109313-128109335 GCTACTAAGGAGGCTGAGGTAGG - Intronic
938834108 2:135082028-135082050 GCTAATCAGGAGGCTGAGGTGGG + Intronic
938877890 2:135552988-135553010 GCTATTAAGGAGGCTGAGGTAGG - Intronic
939916715 2:148054017-148054039 GCTACTCAGCAGGCTGAGGTGGG - Intronic
940227222 2:151412430-151412452 GCTACTAAGGAGGCTGAGGTGGG - Intronic
940501778 2:154503000-154503022 CCTACTAAGGAGGCTGAGGTGGG + Intergenic
940934104 2:159471476-159471498 GCTACTAAGGAGGCTGAGGTTGG + Intronic
940938215 2:159524341-159524363 GCTACTCAGCAGGCTAAGGTGGG + Intronic
940961286 2:159789127-159789149 TCTACTCAGGAGGCTGAGGTGGG - Intronic
941040403 2:160615320-160615342 GCTACTAAGAAGGCTGAGGTGGG + Intergenic
941759949 2:169231180-169231202 TCTACTCAGGAGGCTGAGGTGGG + Intronic
941959751 2:171241958-171241980 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
941992049 2:171567073-171567095 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
942127063 2:172837677-172837699 GCTAATCAGGAGGCTGAGGTGGG - Intronic
942386104 2:175444763-175444785 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
942676722 2:178434528-178434550 TCTACTAGGGAGGCTGAGGTGGG - Intronic
943253620 2:185565059-185565081 TAAAATAAGGAGGCTGAGGTGGG + Intergenic
943338465 2:186647345-186647367 GCTACTAAGGAGGCTGAGGTGGG - Intronic
943387186 2:187216663-187216685 TCTAATTAGCAGGTTTGGGTTGG + Intergenic
943559053 2:189439565-189439587 TGTAACAAGAAGGCTGAGGTAGG - Intergenic
943637480 2:190321963-190321985 TCTACTCAGGAGGCTGAGGTGGG - Intronic
943672348 2:190676606-190676628 GCTAATCAGGAGGCTGAGGTGGG + Intronic
943947099 2:194080797-194080819 GCTACTTAGCAGGCTGAGGTTGG + Intergenic
944040396 2:195347332-195347354 TCTAATTAGTAAGCTTATGTAGG - Intergenic
944232399 2:197409448-197409470 GCTACTAAGAAGGCTGAGGTGGG + Intronic
944450873 2:199841037-199841059 GCTACTCAGCAGGCTGAGGTGGG + Intronic
944462185 2:199961350-199961372 TCTACTTAGGAGGCTGAGGTGGG + Intronic
944562327 2:200952998-200953020 GCTACTCAGGAGGCTTAGGTGGG + Intronic
944596300 2:201264718-201264740 GCTACTCAGCAGGCTGAGGTGGG + Intronic
944727986 2:202491166-202491188 GCTACTCAGCAGGCTGAGGTGGG - Intronic
944752765 2:202728089-202728111 TCTACTCAGCAGGCTGAGGTGGG - Intronic
944806433 2:203286175-203286197 GCTACTCAGGAGGCTTAGGTGGG + Intronic
945298257 2:208192296-208192318 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
946046297 2:216823865-216823887 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
946255696 2:218440379-218440401 TCTACTCAGGAGGCTGAGGTAGG - Intronic
946307426 2:218864369-218864391 GCTAATCAGGAGGCTGAGGTAGG - Intronic
946549220 2:220782422-220782444 GCTACTCAGGAGGCTTAGGTAGG - Intergenic
946577854 2:221095735-221095757 TCTTATAAGCTGGCTTTGGCTGG + Intergenic
947090588 2:226506873-226506895 GCTACTCAGAAGGCTTAGGTGGG + Intergenic
947214211 2:227735416-227735438 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
947425323 2:229978174-229978196 GCTAATCAGGAGGCTGAGGTGGG + Intronic
947494839 2:230627472-230627494 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
947596769 2:231417754-231417776 TCTATTAGGGAGGCTAAGGTAGG + Intergenic
947671594 2:231940133-231940155 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
948583107 2:239001269-239001291 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1168920226 20:1527322-1527344 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1169040923 20:2494655-2494677 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1169098300 20:2923035-2923057 GCTACTTAGCAGGCTGAGGTGGG - Intronic
1169365080 20:4985557-4985579 GCTACTAGGCAGGCTGAGGTGGG - Intronic
1169431600 20:5541277-5541299 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1169816807 20:9665592-9665614 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1169907416 20:10617758-10617780 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1170061507 20:12264372-12264394 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1170196859 20:13697969-13697991 ACTACTAAGAAGGCTGAGGTAGG - Intergenic
1170222705 20:13957764-13957786 GCTACTTAGGAGGCTTAGGTGGG + Intronic
1170789953 20:19499524-19499546 GCTACTCAGCAGGCTAAGGTGGG - Intronic
1170827182 20:19806784-19806806 GCTAATAGGCAAGCTAAGGTGGG + Intergenic
1170845968 20:19962191-19962213 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1170995273 20:21349629-21349651 TCTACTTAGGAGGCTGAGGTGGG + Intronic
1171040088 20:21754874-21754896 GCTACTAAGTAGGCTGAGGTAGG + Intergenic
1171998325 20:31751017-31751039 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1172044265 20:32068830-32068852 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1172132742 20:32666353-32666375 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1172292784 20:33788305-33788327 TCTACTCAGGAGGCTGAGGTAGG + Intronic
1172402861 20:34664866-34664888 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1172976898 20:38912979-38913001 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1173346068 20:42201184-42201206 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1174246237 20:49183407-49183429 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1174305854 20:49613852-49613874 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1174674164 20:52337277-52337299 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1174779875 20:53379268-53379290 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1175421680 20:58838803-58838825 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1175734871 20:61378140-61378162 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1176189046 20:63798730-63798752 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1177072533 21:16528307-16528329 CCTAATTAGGAGGCTGAGGTGGG - Intergenic
1177148118 21:17428361-17428383 GCTACTCAGGAGGCTTAGGTTGG - Intergenic
1177188339 21:17821787-17821809 TCTACTCAGAAGGCTGAGGTGGG + Intergenic
1177659806 21:24068000-24068022 TCTAATAAGTAGCCATAGGGAGG + Intergenic
1178073119 21:28991173-28991195 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1178450069 21:32690317-32690339 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1178499586 21:33114924-33114946 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1178826355 21:36020314-36020336 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1178853027 21:36228857-36228879 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1178997339 21:37415574-37415596 GCTAATAAGGAGGCTAACGTGGG - Intronic
1179335430 21:40447160-40447182 TTTACTAATCAGGCTAAGGTTGG + Intronic
1179458588 21:41517411-41517433 GCTACTAAGCAGGCTGAGGCAGG - Intronic
1179535184 21:42046854-42046876 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1179809594 21:43862050-43862072 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1180106812 21:45624014-45624036 TCTATTCAGGAGGCTGAGGTCGG - Intergenic
1180629274 22:17216251-17216273 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1180704714 22:17802172-17802194 TCTACTAGGGAGGCTAAGGTGGG - Intronic
1180801283 22:18633225-18633247 TCTACTCAGCAGACTGAGGTGGG + Intergenic
1180970741 22:19813882-19813904 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1181183168 22:21081263-21081285 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1181220438 22:21362036-21362058 TCTACTCAGCAGACTGAGGTGGG - Intergenic
1181296331 22:21842477-21842499 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1181331098 22:22091815-22091837 CCTAATCAGGAGGCTGAGGTGGG + Intergenic
1181561721 22:23707259-23707281 TCTAATCAGGAGGCTGAGGTGGG + Intergenic
1182524123 22:30905256-30905278 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1182624697 22:31637249-31637271 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1183384459 22:37506980-37507002 TCTAATATGCAGACTTCGGCTGG + Intronic
1183572840 22:38667120-38667142 GCTATTCAGTAGGCTTAGGTGGG - Intronic
1183630784 22:39031456-39031478 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1183634297 22:39051840-39051862 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1183636985 22:39070155-39070177 GCTAATCAGGAGGCTGAGGTAGG + Intronic
1183812983 22:40273770-40273792 GCTACTAAGAAGGCTGAGGTGGG - Intronic
1183887586 22:40897611-40897633 TATAATCAGGAGGCTGAGGTGGG - Intronic
1184026163 22:41858494-41858516 TGTAATCAGGAGGCTAAGGTGGG + Intronic
1184103311 22:42353061-42353083 GCTATTAAGGAGGCTGAGGTGGG + Intergenic
1184260226 22:43310888-43310910 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1184481698 22:44752113-44752135 TCTACTATGAAGGCTGAGGTGGG + Intronic
1184486292 22:44781944-44781966 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1184570547 22:45321526-45321548 TCTACTAGGAAGGCTGAGGTGGG - Intronic
1185303583 22:50099168-50099190 TCTTATTAGGAGGCTTTGGTGGG + Intronic
949186749 3:1201036-1201058 TCTACTCAGGAGGCTGAGGTGGG - Intronic
949285327 3:2396134-2396156 GCTAATTAGAAGGCTGAGGTGGG - Intronic
949735111 3:7162869-7162891 GCTACTAAGTAGGCTGAGGTAGG - Intronic
949958138 3:9287101-9287123 ACTAATCAGGAGGCTGAGGTAGG - Intronic
949989551 3:9567570-9567592 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
949995229 3:9611428-9611450 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
950261576 3:11546024-11546046 ACTACTAAGGAGGCTGAGGTAGG + Intronic
950501711 3:13368185-13368207 ACTAATCAGGAGGCTGAGGTAGG - Intronic
950875952 3:16273503-16273525 GCTAATCAGGAGGCTTAGGCAGG - Intronic
951139013 3:19139470-19139492 GCTACTTAGCAGGCTGAGGTGGG + Intergenic
951253660 3:20423979-20424001 TGAAATCAGCAGGCATAGGTTGG + Intergenic
951949876 3:28188071-28188093 GCTAATCAAGAGGCTTAGGTGGG + Intergenic
952014642 3:28942077-28942099 GCTAATCAGGAGGCTGAGGTAGG - Intergenic
952050972 3:29384202-29384224 ACTAATAGGGAGGCTGAGGTGGG + Intronic
952368473 3:32696399-32696421 ACTACTCAGGAGGCTTAGGTGGG - Intronic
952459363 3:33508104-33508126 GCTATTCAGCAGGCTGAGGTAGG - Intronic
952470118 3:33639167-33639189 GCTACTAAGGAGGCTGAGGTGGG - Intronic
952627911 3:35428980-35429002 TCTATTCAGGAGGCTGAGGTGGG - Intergenic
953380592 3:42468947-42468969 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
953651990 3:44814419-44814441 TCTACTCAGGAGGCTGAGGTGGG - Intronic
953985129 3:47435936-47435958 GCTACTCAGGAGGCTTAGGTGGG + Intronic
953988609 3:47465655-47465677 CCTACTTAGCAGGCTGAGGTGGG + Intronic
954118716 3:48482291-48482313 GCTACTCAGGAGGCTTAGGTGGG + Intronic
954205994 3:49059365-49059387 GCTATTTAGCAGGCTGAGGTGGG - Intronic
954248561 3:49350827-49350849 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
954252872 3:49381937-49381959 TCTACTCAGGAGGCTGAGGTGGG + Intronic
954351857 3:50051226-50051248 GCTACTAAGCAGGCTGAGGTGGG + Intronic
954446272 3:50548496-50548518 GCTATTAAGGAGGCTGAGGTGGG - Intergenic
954731537 3:52666778-52666800 GCTAATCAGGAGGCTAAGGTGGG + Intronic
954827665 3:53389123-53389145 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
955213651 3:56965141-56965163 GCTACTCAGCAGGCTGAGGTGGG + Intronic
955311597 3:57893320-57893342 GCTAATCAGCACGCTTAGGTGGG + Intronic
955796960 3:62647399-62647421 TCTAATCAGTAGGCCTGGGTTGG + Intronic
956231828 3:67025975-67025997 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
956453881 3:69401659-69401681 GCTAATCAGGAGGCTGAGGTTGG - Intronic
956664765 3:71631828-71631850 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
956818088 3:72927047-72927069 GCTACTCAGGAGGCTTAGGTGGG - Intronic
957545473 3:81631090-81631112 GCTACTCAGTAGGCTTAGGTGGG + Intronic
958605666 3:96355549-96355571 GCTAATAAGGAGGCTAAGGCAGG + Intergenic
958862808 3:99465902-99465924 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
959046464 3:101479694-101479716 GCTAATAGGGAGGCTGAGGTGGG + Intronic
959047541 3:101491367-101491389 GCTACTCAGCAGGCTGAGGTGGG - Intronic
959123467 3:102261709-102261731 GCTACTAAGGAGGCTGAGGTGGG + Intronic
959414356 3:106065635-106065657 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
959519188 3:107306357-107306379 TCTACTCAGCAGGCTGAGGTGGG + Intergenic
959556225 3:107721923-107721945 TCTGATAAGCAGCTTTATGTTGG + Intronic
959689486 3:109183105-109183127 TCTATTCAGGAGGCTGAGGTGGG - Intergenic
960355032 3:116641000-116641022 GCTACTAAGGAGGCTGAGGTAGG + Intronic
960757857 3:121037036-121037058 GCTACTCAGCAGGCTTAAGTGGG - Intronic
961141563 3:124560763-124560785 GCTACTCAGCAGGCTGAGGTGGG + Intronic
961245148 3:125445176-125445198 GCTACTCAGAAGGCTTAGGTAGG - Intergenic
961396172 3:126592704-126592726 TCTACTCAGGAGGCTGAGGTAGG - Intronic
961420077 3:126796236-126796258 TCTACTCAGGAGGCTGAGGTGGG + Intronic
961538301 3:127583384-127583406 GCTAATAGGAAGGCTGAGGTGGG + Intronic
962046158 3:131761325-131761347 GCTACTAAGCAGGCTTAGGTGGG - Intronic
962076403 3:132086832-132086854 TCTACTTAGGAGGCTGAGGTGGG - Intronic
962091567 3:132249428-132249450 GCTACTCAGCAGGCTGAGGTAGG + Intronic
962340183 3:134575721-134575743 GCTACTCAGCAGGCTAAGGTGGG - Intergenic
962573518 3:136735235-136735257 TCTACTCAGGAGGCTGAGGTGGG - Intronic
962771492 3:138614326-138614348 GCTACTAAGGAGGCTGAGGTGGG + Intronic
962796572 3:138854860-138854882 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
963090876 3:141482728-141482750 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
963119861 3:141767510-141767532 GCTAATCAGGAGGCTGAGGTAGG - Intergenic
963350020 3:144140320-144140342 TCTACTCAGAAGGCTAAGGTGGG - Intergenic
963771447 3:149390477-149390499 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
963927477 3:150966200-150966222 TCTACTCAGGAGGCTGAGGTGGG + Intronic
964102118 3:152999670-152999692 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
964123005 3:153206105-153206127 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
964654388 3:159050842-159050864 ACTACTCAGCAGGCTGAGGTGGG + Intronic
964770345 3:160218301-160218323 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
964851725 3:161103124-161103146 GCTACTCTGCAGGCTTAGGTAGG + Exonic
965715663 3:171599718-171599740 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
965831684 3:172797139-172797161 TCTACTCAGGAGGCTGAGGTAGG - Intronic
966606755 3:181828741-181828763 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
966689924 3:182731649-182731671 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
967387984 3:188929108-188929130 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
967533083 3:190571402-190571424 GCTAATCAGGAGGCTGAGGTGGG + Intronic
967639600 3:191845809-191845831 GCTAGTCAGCAGGCTGAGGTGGG - Intergenic
967640034 3:191851364-191851386 GCTAGTCAGCAGGCTGAGGTGGG + Intergenic
967746217 3:193058827-193058849 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
968409735 4:379484-379506 GCTAATAAGGAGGCTGAGGCAGG - Intronic
969091575 4:4697938-4697960 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
969168279 4:5337088-5337110 GCTACTTAGCAGGCTGAGGTGGG - Intronic
969819040 4:9706993-9707015 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
970297785 4:14649713-14649735 GCTATTAAGGAGGCTGAGGTGGG - Intergenic
970372538 4:15422714-15422736 TCTACTCAGAAGGCTGAGGTGGG - Intronic
970385850 4:15555625-15555647 GCTACTAAGGAGGCTGAGGTGGG + Intronic
970391816 4:15619734-15619756 GCTAGTCAGCAGGCTTAGGTGGG + Intronic
971083878 4:23247600-23247622 ACTACTCAGCAGGCTGAGGTAGG - Intergenic
971353750 4:25875934-25875956 TATACTCAGCAGGCTGAGGTGGG - Intronic
971804061 4:31331850-31331872 GCTAATCAGCAGGCTGAGGCAGG + Intergenic
972129166 4:35808340-35808362 GCTAATTAGGAGGCTGAGGTGGG + Intergenic
972292499 4:37702875-37702897 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
972488551 4:39565104-39565126 GCTAATCAGGAGGCTGAGGTGGG + Intronic
973921300 4:55688215-55688237 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
974412827 4:61564384-61564406 GCTACTAAGGAGGCTGAGGTGGG - Intronic
974557940 4:63476581-63476603 GCTAATAGGAAGGCTGAGGTGGG - Intergenic
974972765 4:68849765-68849787 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
975122827 4:70747766-70747788 TCTATTCAGGAGGCTGAGGTGGG + Intronic
975134591 4:70862213-70862235 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
975692770 4:76982320-76982342 GCTACTAAGGAGGCTGAGGTGGG - Intronic
976436593 4:85025516-85025538 GCTACTGAGAAGGCTTAGGTGGG - Intergenic
976653407 4:87460562-87460584 ACTAATTAGGAGGCTGAGGTGGG - Intergenic
977499948 4:97825565-97825587 CCTAATAAGCAGGCACAGTTGGG - Intronic
977905418 4:102472543-102472565 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
978516749 4:109576961-109576983 TCTACTCAGGAGGCTGAGGTGGG - Intronic
978583275 4:110253343-110253365 GCTACTCAGCAGGCTCAGGTGGG - Intergenic
978752154 4:112261856-112261878 GCTACTAAGGAGGCTGAGGTGGG + Intronic
978815936 4:112905771-112905793 GCTACTCAGCAGGCTGAGGTGGG - Intronic
978890323 4:113818526-113818548 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
979059677 4:116042483-116042505 GCTACTCAGCAGGCTGAGGTAGG - Intergenic
979090403 4:116476941-116476963 CCTACTAAGGAGGCTGAGGTGGG - Intergenic
979100955 4:116613531-116613553 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
979249403 4:118549126-118549148 GCTACTAAGAAGGCTGAGGTGGG - Intergenic
979257753 4:118622621-118622643 TCTACTAGGGAGGCTGAGGTGGG - Intergenic
979330594 4:119417941-119417963 TCTACTAGGGAGGCTGAGGTGGG + Intergenic
979744250 4:124190791-124190813 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
979836320 4:125372248-125372270 GCTAATCAGGAGGCTGAGGTGGG + Intronic
980071497 4:128247032-128247054 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
980967082 4:139532325-139532347 GCTACTAAGGAGGCTGAGGTGGG + Intronic
981102726 4:140847971-140847993 GCTACTAAGAAGGCTTAGGTGGG - Intergenic
981611194 4:146595645-146595667 TCTACTCAGGAGGCTCAGGTGGG - Intergenic
981883088 4:149639312-149639334 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
981976927 4:150742255-150742277 GCTACTCAGCAGGCTGAGGTAGG - Intronic
982507828 4:156241939-156241961 GCTAATCAGGAGGCTGAGGTAGG - Intergenic
982579079 4:157155238-157155260 ACTAATTGGGAGGCTTAGGTGGG - Intronic
982702698 4:158673190-158673212 GCTACTCAGGAGGCTTAGGTAGG + Intronic
982714300 4:158790633-158790655 GCTACTAAGGAGGCTGAGGTGGG + Intronic
982724755 4:158894280-158894302 GCTAATCAGGAGGCTGAGGTGGG - Intronic
982761634 4:159291405-159291427 GCTACTAAGGAGGCTGAGGTGGG - Intronic
982915069 4:161197594-161197616 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
983193921 4:164783668-164783690 GCTACTTAGCAGGCTAAGGTGGG + Intergenic
983225007 4:165077631-165077653 GCTACTCAGCAGGCTGAGGTAGG + Exonic
984103548 4:175516267-175516289 TTGAAGAAACAGGCTTAGGTTGG - Intergenic
984246543 4:177281775-177281797 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
984404990 4:179317345-179317367 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
984453218 4:179930432-179930454 ACTACTCAGCAGGCTGAGGTGGG + Intergenic
985138667 4:186815561-186815583 TCTATAAAGTAGGCTTAAGTTGG + Intergenic
985701726 5:1377676-1377698 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
985838714 5:2289714-2289736 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
986181573 5:5397895-5397917 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
986294490 5:6426124-6426146 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
987076120 5:14383211-14383233 TCAAATAAGCAGACATAGCTTGG - Intronic
987334770 5:16889059-16889081 ACTACTCAGCAGGCTGAGGTGGG + Intronic
987335308 5:16893520-16893542 GCTACTCAGCAGGCTGAGGTGGG + Intronic
987691496 5:21272651-21272673 TCTACTCAGAAGGCTGAGGTTGG + Intergenic
987780596 5:22429241-22429263 TCTACTCAGGAGGCTGAGGTGGG - Intronic
988346052 5:30039289-30039311 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
988586342 5:32510790-32510812 TCTAATAGGCAGACTGAGTTGGG + Intergenic
988690406 5:33566350-33566372 TCTACTCAGGAGACTTAGGTGGG + Intronic
988732076 5:33982292-33982314 TCAAATAAGTAGGCTTTGATGGG + Exonic
988909072 5:35821411-35821433 GCTACTAAGGAGGCTAAGGTGGG + Intergenic
989038598 5:37202271-37202293 GCTACTCAGGAGGCTTAGGTGGG - Intronic
989158464 5:38367356-38367378 GCTACTAAGGAGGCTGAGGTGGG - Intronic
989589326 5:43098714-43098736 GCTACTAAGGAGGCTGAGGTGGG + Intronic
990065687 5:51711678-51711700 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
990286256 5:54303397-54303419 GCTACTCAGGAGGCTTAGGTGGG + Intronic
990384954 5:55251538-55251560 TCTATTCAGGAGGCTGAGGTGGG - Intergenic
990681746 5:58252677-58252699 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
991060847 5:62374098-62374120 GCTACTAGGCAGGCTGAGGTGGG + Intronic
991066993 5:62434412-62434434 GCTACTAAGGAGGCTAAGGTGGG - Intronic
991319232 5:65350763-65350785 TCTACTCAGGAGGCTGAGGTAGG - Intronic
991683131 5:69158012-69158034 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
991995266 5:72380220-72380242 TCTAATAAGCAGGATAAGCCAGG + Intergenic
992138567 5:73772488-73772510 GCTAATCAGCAGGCTGAGGTGGG - Intronic
992225765 5:74618619-74618641 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
992401605 5:76416938-76416960 TCTACTCAGAAGGCTGAGGTAGG - Intronic
992518526 5:77522526-77522548 TCTACTCAGGAGGCTAAGGTGGG + Intronic
992819795 5:80485029-80485051 GCTAATCAGGAGGCTAAGGTGGG - Intergenic
992929480 5:81627951-81627973 GCTACTCAGGAGGCTTAGGTGGG + Intronic
993083236 5:83329019-83329041 GCTAATAAGGAGGCTTAAGTGGG - Intronic
993213279 5:84983149-84983171 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
993372379 5:87108720-87108742 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
993385905 5:87262842-87262864 GCTAATTGGGAGGCTTAGGTGGG - Intergenic
993469776 5:88293304-88293326 TATATTAAGCAGCCTTAGGCAGG + Intergenic
993566929 5:89488085-89488107 TCTAATAAGCAGCTTTTGCTGGG + Intergenic
993703712 5:91147053-91147075 GCTACTGAGCAGGCTAAGGTGGG + Intronic
993723227 5:91342109-91342131 GCTAATAGGGAGGCTTAGGCAGG + Intergenic
993949722 5:94159008-94159030 TCTAATAAGAATGCAGAGGTGGG + Intronic
994150778 5:96445318-96445340 GCTACTACGCAGGCTGAGGTGGG + Intergenic
994413956 5:99444051-99444073 GCTACTCAGAAGGCTTAGGTGGG - Intergenic
994841758 5:104932755-104932777 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
995403499 5:111767775-111767797 TCTACTCAGGAGGCTGAGGTGGG - Intronic
995524660 5:113040803-113040825 TCCAATAACCAGCCTTAAGTTGG - Intronic
995997418 5:118318893-118318915 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
996122046 5:119683719-119683741 ACTACTCAGGAGGCTTAGGTGGG - Intergenic
996534328 5:124561557-124561579 GCTAATTGGAAGGCTTAGGTAGG + Intergenic
996603710 5:125296136-125296158 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
996799135 5:127383354-127383376 GCTACCAAGCAGGCTGAGGTGGG + Intronic
997334145 5:133092930-133092952 GCTACTCAGCAGGCTGAGGTAGG - Intronic
997550688 5:134749822-134749844 TCTACTCAGGAGGCTGAGGTGGG - Intronic
997728131 5:136139805-136139827 TCTACTTAGGAGGCTGAGGTGGG - Intronic
997799048 5:136841551-136841573 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
997864586 5:137449781-137449803 GCTACTAAGGAGGCTGAGGTAGG + Intronic
998011518 5:138699320-138699342 GCTACTAAGGAGGCTGAGGTGGG - Intronic
999158481 5:149475368-149475390 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
999292883 5:150438890-150438912 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
999996118 5:157094143-157094165 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1000002726 5:157154343-157154365 GCTACTCAGAAGGCTTAGGTGGG + Intronic
1000093096 5:157947201-157947223 ACTACTAAGAAGGCTGAGGTAGG - Intergenic
1001075307 5:168622537-168622559 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1001567380 5:172708245-172708267 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1002138807 5:177126065-177126087 GCTACTTGGCAGGCTTAGGTAGG - Intergenic
1002141927 5:177147215-177147237 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1002215707 5:177631028-177631050 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1003326365 6:5094370-5094392 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1003508325 6:6758502-6758524 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1003617053 6:7664543-7664565 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1003897375 6:10620517-10620539 TCTACTTAGGAGGCTGAGGTGGG - Intronic
1003905630 6:10696820-10696842 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1004638114 6:17487888-17487910 GCTACTAGGCAGGCTGAGGTGGG - Intronic
1004808187 6:19227266-19227288 TCTAATGAGCACTCTGAGGTAGG + Intergenic
1004958662 6:20759428-20759450 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1005088552 6:22032498-22032520 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1005297624 6:24442232-24442254 TCTACTGAGGAGGCTGAGGTGGG - Intronic
1005452504 6:25987249-25987271 TCCAATTAACAGTCTTAGGTTGG + Intergenic
1005659144 6:27976666-27976688 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1005710131 6:28496463-28496485 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1006308784 6:33242433-33242455 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1006500146 6:34453127-34453149 TCTATTAGGGAGGCTGAGGTGGG + Intergenic
1006721894 6:36160235-36160257 TATAAGAAGCATGCTTAGGCCGG - Intergenic
1006795461 6:36729592-36729614 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1006854751 6:37125002-37125024 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1007454070 6:41962635-41962657 TTTACTGAGGAGGCTTAGGTGGG + Intronic
1007821792 6:44565794-44565816 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1007853119 6:44824411-44824433 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1008271594 6:49496042-49496064 TCTAATCAGGAGGCTGAGGCAGG + Intergenic
1010200379 6:73276553-73276575 TCTAATTGGAAGGCTGAGGTGGG + Intronic
1010426389 6:75733143-75733165 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1010546637 6:77166156-77166178 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1010892157 6:81326497-81326519 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1011368415 6:86605753-86605775 GCTACTAAGCAGGCTGAGGCAGG + Intergenic
1011808675 6:91103410-91103432 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1012488334 6:99747559-99747581 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1012753276 6:103190350-103190372 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1013321273 6:108992208-108992230 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1013526979 6:110983457-110983479 GCTACTCAGCAGGCTGAGGTAGG - Intronic
1013535396 6:111059042-111059064 TCTACTCAGCAGGCTGAGGCAGG - Intergenic
1013547339 6:111171023-111171045 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1013772225 6:113640738-113640760 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1013809476 6:114028207-114028229 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1014553432 6:122816336-122816358 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1014629122 6:123767655-123767677 GCTACTCAGCAGGCTAAGGTAGG + Intergenic
1014630740 6:123786629-123786651 GCTAATTAGAAGGCTGAGGTGGG + Intergenic
1014684656 6:124481229-124481251 TATAATAAGTAGGCTAAGATAGG + Intronic
1015154851 6:130081528-130081550 GCTACTCAGGAGGCTTAGGTAGG - Intronic
1015237635 6:130988975-130988997 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1015767431 6:136733491-136733513 TCTAATAAGCAAAATTATGTAGG - Intronic
1015774641 6:136801223-136801245 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1015933365 6:138384434-138384456 TCAAATAAGGAGACATAGGTGGG + Intergenic
1016467992 6:144345879-144345901 AATAATAAGCAGGCTTTGGCCGG + Intronic
1016838063 6:148498955-148498977 TCTAATAAGCAGGCTTAGGTTGG - Intronic
1017145615 6:151231574-151231596 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1017159019 6:151348213-151348235 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1017560163 6:155618436-155618458 TCTAGTCAGGAGGCTGAGGTGGG + Intergenic
1018023462 6:159785277-159785299 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1019115816 6:169761326-169761348 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1019465289 7:1184820-1184842 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1019739576 7:2665962-2665984 GCTAAGAAGCAGGCTTGGGAAGG + Intergenic
1019875022 7:3802421-3802443 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1019981765 7:4626751-4626773 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1020036974 7:4969797-4969819 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1020054512 7:5107981-5108003 GCTACTAAGGAGGCTTAGGTGGG + Intergenic
1020163310 7:5788882-5788904 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1020202922 7:6094283-6094305 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1020319186 7:6927604-6927626 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1020667896 7:11070187-11070209 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1020807462 7:12808357-12808379 GCTATTAGGCAGGCTGAGGTGGG - Intergenic
1021250313 7:18316980-18317002 GCTAATAGGCAGGCTGAGGCAGG + Intronic
1021316823 7:19157934-19157956 TCTGATAAGCAGGAGGAGGTAGG + Intergenic
1021595408 7:22311135-22311157 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1022117408 7:27274322-27274344 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1022151880 7:27616571-27616593 TCTACTTAGGAGGCTGAGGTGGG - Intronic
1022155738 7:27660819-27660841 TCTAATCAGCACTCTGAGGTAGG + Intronic
1022396500 7:29991759-29991781 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1022429569 7:30303169-30303191 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1022686940 7:32606018-32606040 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1022825545 7:34008951-34008973 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1023438075 7:40159025-40159047 GCTACTCAGCAGGCTGAGGTAGG - Intronic
1023720436 7:43088090-43088112 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1023721639 7:43101450-43101472 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1024476540 7:49818015-49818037 CCTGATGAGCAGGCTAAGGTAGG + Intronic
1024575346 7:50759079-50759101 GCTACTTAGGAGGCTTAGGTGGG + Intronic
1025082661 7:55997045-55997067 GCTATTCAGCAGGCTGAGGTGGG + Intronic
1025113142 7:56236061-56236083 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1025247780 7:57330276-57330298 GCTACTCAGCAGGCTAAGGTGGG + Intergenic
1025842316 7:65162406-65162428 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1025880728 7:65533564-65533586 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1025892709 7:65669040-65669062 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1026125441 7:67575498-67575520 TCTACTCAGAAGGCTGAGGTAGG - Intergenic
1026301551 7:69102305-69102327 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1026422736 7:70257427-70257449 GCTACTAAGAAGGCTTAGGTGGG - Intronic
1026539747 7:71269353-71269375 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1026671493 7:72394771-72394793 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1027263222 7:76479531-76479553 GCTAATAGGGAGGCTGAGGTGGG + Intronic
1027314606 7:76977636-76977658 GCTAATAGGGAGGCTGAGGTGGG + Intergenic
1027693848 7:81383597-81383619 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1028901859 7:96110081-96110103 TATAACAAGCAGGCATAGCTGGG - Intergenic
1029221960 7:98997192-98997214 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1029318775 7:99738755-99738777 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1029323705 7:99787735-99787757 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1029811340 7:103052333-103052355 TCTACTTAGGAGGCTGAGGTAGG - Intronic
1029995854 7:105007514-105007536 TTTACTTAGGAGGCTTAGGTGGG - Intergenic
1030078156 7:105754570-105754592 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1030169849 7:106590094-106590116 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1030177518 7:106670416-106670438 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1030546014 7:110896066-110896088 TCTAATCAGGAGGCTGAGGTGGG - Intronic
1030604518 7:111625450-111625472 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1030627400 7:111859128-111859150 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1030895801 7:115058411-115058433 GCTAATGAGGAGGCTGAGGTGGG + Intergenic
1031623427 7:123964634-123964656 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1031718915 7:125144135-125144157 TGTAATGAGGAGGCTTAGGATGG - Intergenic
1032036666 7:128526564-128526586 GCTACTCAGCAGGCTGAGGTTGG - Intergenic
1032040867 7:128559730-128559752 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1032684630 7:134220678-134220700 ACTAATTGGCAGGCTAAGGTGGG - Intronic
1033136338 7:138787538-138787560 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1033167319 7:139051516-139051538 TCTACTCAGCAGGGTGAGGTGGG - Intronic
1033175551 7:139120193-139120215 TCTACTAGGGAGGCTGAGGTGGG + Intergenic
1033487136 7:141801945-141801967 TCCAATGAGAAGGCTTAGGGCGG + Intergenic
1033937666 7:146607586-146607608 GCTACTTGGCAGGCTTAGGTGGG - Intronic
1033988458 7:147255331-147255353 TCTAATTGGGAGGCTGAGGTGGG - Intronic
1034539892 7:151750767-151750789 GCTACTAAGGAGGCTAAGGTGGG + Intronic
1035186695 7:157131816-157131838 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1035918093 8:3646890-3646912 TTTGATGAGTAGGCTTAGGTAGG + Intronic
1036492319 8:9239160-9239182 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1036697890 8:10990689-10990711 GCTACTCTGCAGGCTTAGGTGGG - Intronic
1036727869 8:11236213-11236235 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1036933423 8:12977915-12977937 TCTACTAGGGAGGCTGAGGTGGG + Intronic
1037155956 8:15698956-15698978 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1038121370 8:24619948-24619970 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1038464088 8:27743780-27743802 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1038485473 8:27932089-27932111 GCTACTAAGCAGTCTGAGGTAGG - Intronic
1038541548 8:28394181-28394203 TCTACTCAGCAGGCTGAGGCAGG + Intronic
1038886552 8:31669165-31669187 TCTACTAGGGAGGCTGAGGTGGG - Intronic
1039370274 8:36977461-36977483 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1039797408 8:40927044-40927066 ACTAATCAGGAGGCTTAAGTGGG - Intergenic
1039884539 8:41647547-41647569 TCTACTAAGCAGGATCAGATGGG - Intronic
1040047911 8:42981770-42981792 GCTACTCAGCAGGCTGAGGTAGG + Intronic
1040048093 8:42983593-42983615 ACTACTAAGCAGGCTGAGGTAGG - Intronic
1040354146 8:46599734-46599756 GCTACTAGGCAGGCTGAGGTGGG + Intergenic
1041022819 8:53655936-53655958 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1041047597 8:53902127-53902149 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1041237030 8:55814057-55814079 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1041398171 8:57413456-57413478 TTTGATATGCAGGCTTAGTTTGG - Intergenic
1041655981 8:60351077-60351099 GCTAATCAGGAGGCTTAGGCAGG - Intergenic
1041681806 8:60601447-60601469 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1041685304 8:60639155-60639177 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1041698029 8:60758245-60758267 TCTACTAAGGAGGCTGAGGTAGG - Intronic
1041707148 8:60858717-60858739 TCTACTAGGGAGGCTGAGGTGGG - Intronic
1041707715 8:60864221-60864243 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1041913262 8:63112613-63112635 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1042165127 8:65937931-65937953 TCTACTAAGGAGGCTGAGGCAGG - Intergenic
1042256653 8:66811125-66811147 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1042259709 8:66845635-66845657 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1042263824 8:66888190-66888212 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1042329287 8:67560946-67560968 TCAAATAATCAGGGTTGGGTAGG - Intronic
1042846200 8:73171775-73171797 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1043427293 8:80160077-80160099 GCTACTCAGGAGGCTTAGGTAGG + Intronic
1043431629 8:80200677-80200699 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1043449131 8:80349248-80349270 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1043484566 8:80686491-80686513 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1044587989 8:93885679-93885701 GCTAATCAGTAGGCTGAGGTGGG - Intronic
1044668927 8:94659016-94659038 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1044975559 8:97661829-97661851 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1046916333 8:119681739-119681761 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1048034351 8:130662913-130662935 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1048140523 8:131789938-131789960 CCTAAACAGCAGGCTCAGGTGGG + Intergenic
1048471133 8:134705310-134705332 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1049095087 8:140544001-140544023 TCTAAGAAGCAGTCAGAGGTGGG - Intronic
1049117417 8:140701511-140701533 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1049834644 8:144726940-144726962 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1049976825 9:868087-868109 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1050051003 9:1601489-1601511 GTTAATAAGCAGGCTAATGTTGG + Intergenic
1050226657 9:3465400-3465422 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1050335700 9:4588224-4588246 GCTACTCAGTAGGCTTAGGTGGG + Intronic
1050476633 9:6047562-6047584 ACTAATGATCAGGCTGAGGTGGG + Intergenic
1050551358 9:6751332-6751354 TCTACTAGGGAGGCTGAGGTGGG + Intronic
1051409944 9:16779190-16779212 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1051623754 9:19078674-19078696 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1051758194 9:20429254-20429276 GCTAATCAGCAGGCTGAGGCAGG + Intronic
1051768284 9:20547838-20547860 GCTACTCAGGAGGCTTAGGTGGG + Intronic
1052044384 9:23777482-23777504 TGTAAAAAGCATGCTTGGGTGGG - Intronic
1052519343 9:29525058-29525080 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1052931306 9:34057760-34057782 ACTACTAAGGAGGCTGAGGTGGG + Intergenic
1052986627 9:34492629-34492651 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1053074138 9:35118505-35118527 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1053240543 9:36491087-36491109 GCTACTCAGCAGGCTGAGGTAGG + Intergenic
1053338152 9:37296822-37296844 GCTAATATGGAGGCTGAGGTGGG - Intronic
1053558344 9:39161734-39161756 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1054138771 9:61457207-61457229 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1054711347 9:68514219-68514241 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1054824019 9:69553013-69553035 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1055034754 9:71806502-71806524 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1055525941 9:77134047-77134069 TCTACTAGGGAGGCTGAGGTGGG - Intergenic
1056403812 9:86254951-86254973 GCTACTGAGGAGGCTTAGGTGGG + Intronic
1056984608 9:91351079-91351101 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1057096198 9:92312340-92312362 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1057171052 9:92963409-92963431 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1057301088 9:93882941-93882963 GCTACTAAGGAGGCTGAGGTAGG + Intergenic
1057364478 9:94406177-94406199 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1057374976 9:94513159-94513181 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1057586872 9:96336292-96336314 GCTAATCAGGAGGCTAAGGTAGG + Intronic
1057658852 9:96981891-96981913 TCTACTCAGGAGGCTGAGGTGGG + Intronic
1057783640 9:98070921-98070943 GCTACTAAGAAGGCTGAGGTGGG - Intronic
1057816276 9:98297910-98297932 GCTACTAAGGAGGCTGAGGTAGG + Intronic
1058194221 9:101953985-101954007 GCTACTAAGGAGGCTAAGGTGGG + Intergenic
1058640366 9:107078021-107078043 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1059192520 9:112340074-112340096 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1059314372 9:113411408-113411430 GCTACTAAGGAGGCTGAGGTAGG - Intronic
1059491269 9:114669388-114669410 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1059616275 9:115954898-115954920 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1059727231 9:117021017-117021039 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1059959378 9:119550298-119550320 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1060096425 9:120794448-120794470 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1060462820 9:123874513-123874535 TCTACTAAGGAGGCTAAGGTGGG + Intronic
1060899985 9:127248717-127248739 GCTAATCAGGAGGCTGAGGTGGG - Intronic
1061251103 9:129426974-129426996 GCTACTAAGGAGGCTGAGGTGGG + Intergenic
1061465024 9:130771329-130771351 TCTACTTAGAAGGCTGAGGTGGG - Intronic
1061530623 9:131209264-131209286 ACTACTAAGGAGGCTGAGGTGGG + Intronic
1061626010 9:131841076-131841098 GCTACTCAGGAGGCTTAGGTAGG + Intergenic
1062355836 9:136161858-136161880 GCTAATCAGGAGGCTGAGGTGGG - Intergenic
1203452322 Un_GL000219v1:130776-130798 TCTACTCAGGAGGCTGAGGTAGG + Intergenic
1185740490 X:2528103-2528125 GCTAATAGGGAGGCTGAGGTAGG - Intergenic
1185764762 X:2716446-2716468 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1185939150 X:4295032-4295054 TCTACTAAGGAGGTTGAGGTAGG + Intergenic
1186097713 X:6120069-6120091 GCTACTAAGAAGGCTGAGGTGGG + Intronic
1186147457 X:6639209-6639231 TCTACTCAGGAGGCTAAGGTGGG + Intergenic
1186156877 X:6734648-6734670 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1186160684 X:6774025-6774047 TCTACTCAGCAGGCTGAGGCAGG + Intergenic
1186225404 X:7394083-7394105 GCTAATTAGGAGGCTGAGGTGGG - Intergenic
1186567641 X:10680912-10680934 TGTATTCAGCAGGCTGAGGTGGG + Intronic
1186750209 X:12614044-12614066 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1186902710 X:14074945-14074967 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1187411034 X:19050639-19050661 GCTACTCAGGAGGCTTAGGTAGG + Intronic
1187788466 X:22920748-22920770 TTTATTGAGCAGTCTTAGGTTGG + Intergenic
1187870154 X:23758276-23758298 GCTACTCAGCAGGCTGAGGTGGG - Intronic
1187970342 X:24652445-24652467 TCTACTAAGGAGGCTGAGGCAGG + Intronic
1188152941 X:26701583-26701605 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1188358005 X:29216299-29216321 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1188368673 X:29341916-29341938 GCTAATCAGGAGGCTGAGGTAGG - Intronic
1189871050 X:45383074-45383096 GCTATTAAGAAGGCTGAGGTAGG + Intergenic
1190085048 X:47388196-47388218 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1190294583 X:49017832-49017854 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1190557656 X:51652597-51652619 GCTACTCAGGAGGCTTAGGTGGG - Intergenic
1190634771 X:52422812-52422834 GCTATTAAGCAGGCTGAGGCAGG + Intergenic
1190742295 X:53297436-53297458 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1191654357 X:63579703-63579725 TCCAATAAAAAGGCTTAGGGTGG + Intergenic
1192752860 X:74012468-74012490 TCTAATCAGAAGGCTGAGGGGGG - Intergenic
1192787728 X:74351361-74351383 ACTACTAAGAAGGCTGAGGTAGG + Intergenic
1193134301 X:77952891-77952913 GCTACTCAGGAGGCTTAGGTGGG - Intronic
1193152969 X:78143636-78143658 GCTACTAAGGAGGCTGAGGTGGG - Intergenic
1193442699 X:81562908-81562930 GCTAATCAGGAGGCTGAGGTAGG + Intergenic
1193938290 X:87650205-87650227 ACTACTAAGGAGGCTGAGGTAGG - Intronic
1194102803 X:89727694-89727716 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1194227448 X:91278956-91278978 CCTAATAAACAGGCATAGCTGGG + Intergenic
1194361293 X:92953632-92953654 GCTAATTAGGAGGCTGAGGTAGG + Intergenic
1194707503 X:97193122-97193144 GCTACTAAGGAGGCTGAGGTGGG - Intronic
1195024986 X:100867617-100867639 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1195663642 X:107407920-107407942 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
1196068233 X:111489461-111489483 TCTACTCAGGAGGCTGAGGTAGG + Intergenic
1196107047 X:111907511-111907533 GCTACTAAGGAGGCTGAGGTGGG + Intronic
1196119482 X:112033817-112033839 ACTAATAAGGAGGCTGAGGCAGG + Intronic
1196209723 X:112982176-112982198 GCTACTTAGGAGGCTTAGGTGGG + Intergenic
1196327799 X:114428675-114428697 GCTACTAAGTAGGCTGAGGTGGG + Intergenic
1196440460 X:115715197-115715219 GCTACTCAGCAGGCTGAGGTGGG - Intergenic
1196460849 X:115928738-115928760 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1196726260 X:118898587-118898609 GCTAATCAGAAGGCTGAGGTAGG - Intergenic
1196817700 X:119678125-119678147 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1196841716 X:119865435-119865457 GCTAATCAGGAGGCTTAGGCAGG - Intergenic
1197209362 X:123816389-123816411 GCTACTAAGAAGGCTAAGGTGGG + Intergenic
1197244594 X:124155061-124155083 CCTAATAGGCAGGCATAGCTGGG + Intronic
1197305158 X:124832684-124832706 TCTACTCAGGAGGCTGAGGTGGG - Intronic
1197823439 X:130564392-130564414 GCTACTCAGCAGGCTAAGGTGGG - Intergenic
1198081359 X:133242975-133242997 GCTAATCAGGAGGCTGAGGTTGG - Intergenic
1198163893 X:134034439-134034461 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1198327809 X:135591553-135591575 GCTAATCAGGAGGCTGAGGTGGG + Intergenic
1198371728 X:135996141-135996163 GCTACTAAGGAGGCTGAGGTTGG - Intronic
1198403241 X:136287875-136287897 TCTACTCAGGAGGCTGAGGTGGG - Intergenic
1198457774 X:136834133-136834155 GCTAATAGGGAGGCTGAGGTAGG + Intergenic
1198465106 X:136897921-136897943 GCTACTCAGCAGGCTGAGGTAGG - Intergenic
1198549587 X:137730965-137730987 GCTACTAAGGAGGCTGAGGTAGG - Intergenic
1198939393 X:141936204-141936226 CCTAATAAACAGCCATAGGTAGG - Intergenic
1199126785 X:144131740-144131762 GCTATTCAGGAGGCTTAGGTGGG - Intergenic
1199360684 X:146914843-146914865 ATTAATAAGCAAGCTAAGGTTGG - Intergenic
1199754240 X:150849568-150849590 GCTACTCAGCAGGCTGAGGTGGG + Intronic
1199757602 X:150879811-150879833 GCTAATCAGGAGGCTAAGGTGGG + Intronic
1199814140 X:151382443-151382465 GCTACTCAGCAGGCTGAGGTGGG + Intergenic
1200177975 X:154131337-154131359 TTTAAAAATCAGGCATAGGTTGG - Intergenic
1200243606 X:154510813-154510835 GCTAATCAGGAGGCTGAGGTGGG + Intronic
1200669488 Y:6069478-6069500 GCTAATTAGCAGGCTGAGGTAGG + Intergenic
1200732945 Y:6762305-6762327 TCTACTCAGCAGGCTGAGGTGGG - Intergenic
1200809212 Y:7464639-7464661 TCTACTCAGGAGGCTGAGGTGGG + Intergenic
1201288249 Y:12397539-12397561 GCTACTTAGCAGGCTGAGGTGGG - Intergenic
1201447233 Y:14070927-14070949 TCTACTCAGGAGGCTGAGGTAGG - Intergenic
1201477913 Y:14403954-14403976 GCTAATAGGGAGGCTGAGGTGGG - Intergenic
1201592727 Y:15633209-15633231 GCTACTCAGGAGGCTTAGGTGGG + Intergenic
1202602753 Y:26610876-26610898 GCTACTCAGGAGGCTTAGGTGGG + Intergenic