ID: 1016839941

View in Genome Browser
Species Human (GRCh38)
Location 6:148516179-148516201
Sequence CAGGCTTCACAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 434}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016839936_1016839941 23 Left 1016839936 6:148516133-148516155 CCATATGGAATTCTGGCTCTGAA 0: 1
1: 0
2: 3
3: 9
4: 180
Right 1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG 0: 1
1: 0
2: 6
3: 45
4: 434

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016839941 Original CRISPR CAGGCTTCACAGATGGAAGA TGG Intronic
900544856 1:3222795-3222817 CAGGAATCACAGATGGATGTGGG - Intronic
900682856 1:3926407-3926429 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
900822033 1:4897200-4897222 CTGGCTTCACAGAAGCAGGAGGG + Intergenic
900889977 1:5442522-5442544 CTGGCTTTAAAGATGGAGGAGGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902789207 1:18753991-18754013 CTGGCTTCACAAAAGGAGGAAGG - Intergenic
903688746 1:25153931-25153953 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
905413662 1:37790083-37790105 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
905449975 1:38049830-38049852 GAGGCTCCACAGATGAAATAAGG + Intergenic
905956035 1:41996889-41996911 CTGCCTTCAAAGATGGTAGAAGG - Intronic
906191555 1:43902480-43902502 GAGAGTTCTCAGATGGAAGAAGG - Intronic
907021435 1:51070141-51070163 CAGGCCTCCCAGATGGTAGCAGG + Intergenic
907548661 1:55285531-55285553 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
910158840 1:84252162-84252184 AAGACGTAACAGATGGAAGAGGG + Intergenic
910865982 1:91788330-91788352 CAGGCCACAGAGAGGGAAGAAGG + Intronic
911026034 1:93435969-93435991 CTGGCTTTAAAGATGGAGGATGG - Intergenic
911365655 1:96934529-96934551 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
911686852 1:100787247-100787269 CAGCCTTTAGAGATGGGAGAGGG + Intergenic
911715772 1:101131215-101131237 CAAGTTTCACATATGGAAGTGGG - Intergenic
912514082 1:110207262-110207284 CAGGTTTCAAAGAAGGAAGATGG + Intergenic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914372537 1:147041535-147041557 CATGCCTCACAGAAGGAAAATGG + Intergenic
914986129 1:152458645-152458667 GAAGTTTCAGAGATGGAAGACGG + Intergenic
915585643 1:156842406-156842428 CAGGCCGCAAAGATCGAAGATGG + Exonic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
917322530 1:173798350-173798372 CAGGCAGCAAAGTTGGAAGAAGG + Intergenic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
917611035 1:176689239-176689261 CAAGCTACACAGATAGAAGTTGG + Intronic
917887223 1:179398571-179398593 GAGGCAGCACAGCTGGAAGAGGG + Intronic
918072098 1:181140670-181140692 CAGTGTTCTCAGCTGGAAGATGG + Intergenic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
918405116 1:184204478-184204500 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
918477521 1:184941096-184941118 CAGTTTTGACAAATGGAAGAAGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918780148 1:188689746-188689768 CAGACCTCACAGATGGCAGCTGG + Intergenic
919371206 1:196728478-196728500 CAGTCTGCATAAATGGAAGATGG + Exonic
919500863 1:198336768-198336790 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
919787695 1:201270253-201270275 CAGACTTCAGACATGGCAGAAGG + Intergenic
920186383 1:204161849-204161871 CAGGCTTTCCAGCTGGAAAATGG + Intronic
921181517 1:212635520-212635542 CAGTCTTCAGAGATGGATGAGGG + Intergenic
921749230 1:218773803-218773825 CTGGCTTTAAAGATGGAAGAAGG - Intergenic
921837351 1:219791952-219791974 AAGGCTTCACAGAGGGAATGTGG + Intronic
922193699 1:223341481-223341503 CAGCCTTCACAGCTGGAAGGTGG - Intronic
922403104 1:225281282-225281304 CTGGCTTTACAGATGGATAAAGG - Intronic
923642210 1:235775667-235775689 AAGGCTACACAGAGAGAAGATGG + Intronic
924804655 1:247352739-247352761 CAGGCTTTTCAGATTGAAGGTGG - Intergenic
924903236 1:248424631-248424653 CAGGCTTCAGAGAGGATAGATGG + Intergenic
924924629 1:248667167-248667189 CAGGCTTCAGAGAGGATAGATGG - Intergenic
1063168815 10:3487489-3487511 CAGACTTCAAGGAGGGAAGAGGG - Intergenic
1063913381 10:10854921-10854943 CAGGCTTGACAGGTGGACGCTGG - Intergenic
1064618284 10:17186459-17186481 CTGGCTTCAAAGATAGAAAAAGG + Intronic
1066433525 10:35375324-35375346 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1066477891 10:35765315-35765337 CAGGCTGCACGGTGGGAAGACGG - Intergenic
1067381628 10:45779109-45779131 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1067889327 10:50119743-50119765 CAGGCTCCACAGAAAGAAGTAGG + Exonic
1068089321 10:52413186-52413208 AGGGCTTCACAGATGGTGGATGG - Intergenic
1068105955 10:52616622-52616644 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1068138352 10:52973444-52973466 CATGCTTCACAGAAGGAAGGGGG - Intergenic
1068149617 10:53115407-53115429 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1068711661 10:60141518-60141540 CAGTGTACCCAGATGGAAGATGG - Intronic
1068988698 10:63130067-63130089 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1070629453 10:78074568-78074590 CTGGCTTTGAAGATGGAAGAGGG + Intergenic
1072564771 10:96608305-96608327 CAGGGATCACAGGTGGCAGAAGG - Intronic
1073673368 10:105617320-105617342 TTGGCTTCAAAGATGGAGGAAGG + Intergenic
1074034898 10:109728663-109728685 CATGCTTCAAAGAAGGGAGATGG + Intergenic
1074576761 10:114677061-114677083 CAGGCTTTTCAGAAGTAAGAGGG - Intronic
1076120470 10:127932972-127932994 CGGGCTTTAAAGATGGAGGAAGG - Intronic
1076513403 10:131028241-131028263 CATGTTTGACAGATTGAAGATGG + Intergenic
1077242090 11:1515901-1515923 CAGCCTTCACAGAGGCACGAGGG + Intergenic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1079370974 11:19851974-19851996 CAGGCTTTGAAGGTGGAAGAAGG + Intronic
1080228397 11:29987009-29987031 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080963723 11:37190002-37190024 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1081386919 11:42482826-42482848 CAGCCTTCACATTTGGAAAAAGG - Intergenic
1081845136 11:46235477-46235499 CTGGGTTCAGAGATAGAAGATGG + Intergenic
1082717499 11:56632863-56632885 GAGCCATCACACATGGAAGAAGG + Intergenic
1083891798 11:65599352-65599374 CCTGCTTCACATATGGGAGACGG - Intronic
1084016945 11:66389371-66389393 TAGGCTTCAAAGATGGTAGGAGG + Intergenic
1085016194 11:73175608-73175630 AAGGCCGCACAGATGGTAGATGG + Intergenic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1085568623 11:77539464-77539486 CAGTTTTAAGAGATGGAAGAAGG + Intronic
1085836192 11:79959316-79959338 CACGCTTCACAGATCGAAAGTGG - Intergenic
1086033967 11:82394587-82394609 CAGGGTTCCCAGAAGAAAGATGG + Intergenic
1087504909 11:99007345-99007367 CAGCCTTAATAGAAGGAAGATGG - Intergenic
1089219171 11:116856465-116856487 CACGCTTGTTAGATGGAAGAAGG - Intronic
1089900117 11:121973232-121973254 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1090416831 11:126546319-126546341 AAGGCTTCCCAGCTGGTAGATGG + Intronic
1092671980 12:10873587-10873609 CTAGCTTTAAAGATGGAAGAGGG - Intronic
1092870184 12:12799436-12799458 CAGGCTTTGAAGATGGAGGAAGG - Intronic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1093705881 12:22274720-22274742 CAGGCAACAGCGATGGAAGAAGG - Intronic
1095864655 12:46958122-46958144 CCAGCTTCACAGATGGATAATGG + Intergenic
1096252341 12:50041171-50041193 AAGGCTTCACAGAGGCAGGAGGG - Intergenic
1096635973 12:52959850-52959872 CTGGCTTTAAAGATGGCAGATGG - Intergenic
1096646147 12:53037397-53037419 CTGGCTTCACAGATGCACGAAGG + Exonic
1098387689 12:69935991-69936013 CAGGCCACACAGATGGGAGCAGG - Intronic
1099016437 12:77348942-77348964 CTGGTTTTAAAGATGGAAGAAGG - Intergenic
1099030474 12:77520145-77520167 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1099885760 12:88528199-88528221 CTGGCTTCAAAGATGGAAGAGGG - Intronic
1099916347 12:88898938-88898960 CAGCCTTTAAAGATCGAAGAAGG - Intergenic
1100401035 12:94230104-94230126 CAGGCATCAGAGATGGAGAATGG - Intronic
1101048847 12:100839715-100839737 CAGCCTTCACAAATGAAATAAGG - Intronic
1101053164 12:100885044-100885066 CTGGCTTCAAACATGAAAGAGGG - Intronic
1101212410 12:102547651-102547673 CAGACTTCACAGATGATTGAAGG + Intergenic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1103005468 12:117417030-117417052 CAGGCATCACAGGTGGCAGGTGG - Intronic
1104684573 12:130776366-130776388 CTGGCTTCCCAGCTGGAAGGAGG + Intergenic
1105461224 13:20590077-20590099 CAGGGTTTACAAATGGAAAAAGG - Intronic
1106473301 13:30076947-30076969 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1106873280 13:34044619-34044641 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1109266057 13:60201615-60201637 CTGGCTTTAGAGATGGAGGAAGG - Intergenic
1109706144 13:66095013-66095035 CTGGTTTCGAAGATGGAAGAAGG + Intergenic
1110427726 13:75388071-75388093 CCGGCTTTGCAGGTGGAAGAAGG - Intronic
1110480055 13:75963473-75963495 CAGGCTTGTCAGATGGAAACAGG - Intergenic
1112191356 13:97181024-97181046 CTGGCTTTCAAGATGGAAGAAGG - Intergenic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1113084237 13:106551160-106551182 CAGGCTACTCAGATGGCAAAAGG - Intronic
1113769009 13:112896851-112896873 CCCGCCTCACAGATGGAACAGGG + Intronic
1113978876 13:114254898-114254920 CAGGCTTCAGAGAGGATAGATGG - Intronic
1115174227 14:30544175-30544197 CTGGCTTTAAAGATGAAAGAAGG + Intergenic
1115597539 14:34923681-34923703 CTGGCTTCAAAGGTAGAAGAAGG - Intergenic
1115995434 14:39190842-39190864 CAAGATCCACAGATGTAAGAAGG - Intergenic
1116060753 14:39921386-39921408 CAGGTTTCTCACATGGCAGAAGG + Intergenic
1116984735 14:51206517-51206539 CATCCTTCAGAGAGGGAAGAGGG - Intergenic
1117087848 14:52219822-52219844 CATGCTCCAGAAATGGAAGAAGG - Intergenic
1117118885 14:52547794-52547816 TAGGCTTCACATAGTGAAGATGG + Intronic
1117442173 14:55770291-55770313 AAGAGTTCAGAGATGGAAGATGG + Intergenic
1118070692 14:62244035-62244057 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1118236556 14:64010439-64010461 CAGGCTTGACAGAAGGAAGACGG + Intronic
1119165314 14:72487614-72487636 CTGGCTTTGCAGATGGAAGGGGG + Intronic
1119505759 14:75171579-75171601 CTGGCTTTAAAGATGGAGGAAGG + Intronic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119959159 14:78834959-78834981 CAGGCATCACAGATGGACTGGGG - Intronic
1120252087 14:82070175-82070197 CTGGCTTCGAAGATGGAGGAAGG + Intergenic
1120261626 14:82192254-82192276 CTGGTTTCAAAGAAGGAAGATGG + Intergenic
1122036249 14:98951227-98951249 CAGGCTTGACAGATGACAGATGG - Intergenic
1122794684 14:104200229-104200251 CAGGCTGCACAGTAGGCAGATGG - Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1123820953 15:24030250-24030272 CATGCTTCACAGATGTGAGTGGG + Intergenic
1124556634 15:30731874-30731896 CAGCCTTCACAGACAGAAGAAGG + Intronic
1124674644 15:31673863-31673885 CAGCCTTCACAGAGAGAAGAAGG - Intronic
1124828646 15:33126230-33126252 TAGACTTCAGAGAAGGAAGATGG + Intronic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1127351905 15:58161366-58161388 CAGGTTCCATACATGGAAGAAGG - Intronic
1127899630 15:63331343-63331365 CAGGCATCAAAGATGGTACAGGG + Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1129576117 15:76747764-76747786 CTGACTTCACTGATGGCAGAAGG - Intronic
1129943224 15:79516737-79516759 CAGGTTTCTCAGATAGGAGAAGG - Intergenic
1129952701 15:79606142-79606164 CAGGCTTCTCACATGTAAAATGG + Intergenic
1130057291 15:80537569-80537591 CAGGCATCACAGATTGATCATGG - Intronic
1130219454 15:82006886-82006908 CTGGATTCAAACATGGAAGAAGG + Intergenic
1130316538 15:82801420-82801442 CAGCCTTCTCTGATGGTAGACGG + Intronic
1130893841 15:88155296-88155318 CTGGCTTTGAAGATGGAAGAGGG + Intronic
1131136025 15:89936382-89936404 CAGGCATCACAGTAGGAACAAGG + Intergenic
1131530768 15:93189893-93189915 CCTGATTCACAGCTGGAAGATGG + Intergenic
1132283146 15:100637857-100637879 CTGGCTTCACAGAAGGCAGCTGG - Intronic
1133027783 16:2996238-2996260 CAGGCTTCTTAGAGGGAAGGGGG + Intergenic
1133233162 16:4375889-4375911 CTGGCGTCACAGGTGGGAGACGG + Intronic
1133472612 16:6090110-6090132 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1133625168 16:7564221-7564243 CTGTGTTCTCAGATGGAAGAGGG - Intronic
1133927363 16:10204072-10204094 AAGGCTGCACAGATTTAAGATGG - Intergenic
1134012227 16:10863384-10863406 CTGGCTTCAGAGATGAAGGAAGG - Intergenic
1134600514 16:15530072-15530094 CTGGCTTCGGAGATGGAGGAGGG - Intronic
1135975245 16:27104451-27104473 CAGGCTCCACAGAGGGAATGAGG - Intergenic
1137299362 16:47132894-47132916 AAGGCCTCACAGCTGGTAGAAGG - Intronic
1137913622 16:52404636-52404658 CAGGCTTCTCAGAGGCAAGTGGG - Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1139302568 16:65958023-65958045 CAGGCTTCAAAGAGGAAAGATGG + Intergenic
1140706969 16:77639851-77639873 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141784218 16:86187721-86187743 TGGGCTCCACAGATGGGAGAAGG + Intergenic
1142245018 16:88966415-88966437 CATGCTGCACAGGTGGGAGAGGG - Intronic
1143867887 17:9937355-9937377 CAGGCTGGAGAGATGGAAGCCGG + Intronic
1146069874 17:29670299-29670321 CATGCTTTACAGCTGGATGATGG - Intronic
1148264569 17:46215275-46215297 CAGGGTTCACAGAAGGAACTGGG + Intronic
1148862576 17:50612378-50612400 CCGGCTTCCCAGATGGAGGGAGG + Intronic
1149150435 17:53556042-53556064 CAGGCTTCATAAATTGAAGGTGG + Intergenic
1149219061 17:54393837-54393859 CAAGCGTCATAGATGGCAGAGGG - Intergenic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1150613426 17:66751331-66751353 CAGGGCTCACAGATGGCACATGG + Intronic
1150640577 17:66946972-66946994 CAGGCTTCACATCTGTAAAATGG + Intergenic
1150642802 17:66961017-66961039 CAGGTTTCACACCTGGAGGATGG - Intergenic
1151129650 17:71883186-71883208 AAGGCTTGAAAGATGGAGGAGGG + Intergenic
1151158558 17:72145134-72145156 AAGGCATCTCAGATGGAAGGAGG - Intergenic
1151275866 17:73033870-73033892 CATGTTTGACAGCTGGAAGAAGG - Intronic
1151373386 17:73665272-73665294 CAGGCTGCAAATATGGAAGGCGG - Intergenic
1151473120 17:74330236-74330258 CAGGCTGCACAGCTGGCAAATGG - Intronic
1153014943 18:575129-575151 GAGACTTAACAGCTGGAAGAGGG - Intergenic
1153164208 18:2243570-2243592 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1153167349 18:2277797-2277819 CTGGCTTCAAAGCTGAAAGAAGG - Intergenic
1153262587 18:3238836-3238858 CTGGCCTTAAAGATGGAAGAAGG - Intergenic
1153304591 18:3620281-3620303 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1154113336 18:11589559-11589581 CAGGCTCCACAGATCAAGGATGG + Intergenic
1154976628 18:21463464-21463486 CAGGGTTCTCAAATGAAAGATGG + Intronic
1155936293 18:31758098-31758120 CATCCTTTACAGCTGGAAGAAGG + Intergenic
1156161891 18:34369605-34369627 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
1156209899 18:34928359-34928381 CAGGCTTCAAGGATGGGGGAGGG + Intergenic
1159840668 18:73394949-73394971 CTGGCTTTACAGATGGATGAAGG - Intergenic
1159978513 18:74746646-74746668 CAAGATACAGAGATGGAAGATGG - Intronic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1161759277 19:6159366-6159388 CAGCATTCCCAGCTGGAAGAAGG - Intronic
1161806368 19:6445489-6445511 CTGGCTTTGAAGATGGAAGAAGG + Intronic
1161996801 19:7718070-7718092 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1164634364 19:29781715-29781737 CGGGCTACAGAGATGGAAGCGGG + Intergenic
1166400993 19:42479897-42479919 CTGGTTTCAAAGATGGAAAAGGG - Intergenic
1166681194 19:44768177-44768199 CAGACTCCAAAGATGGAGGAAGG + Intergenic
1167188777 19:47967831-47967853 CAAGCAACACAGATGGAAGTAGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1167883319 19:52480458-52480480 CATCCTTTACAGCTGGAAGAAGG - Intronic
1168014415 19:53560720-53560742 CAGGCTTTGCTGATGGAAGAAGG - Intronic
925447827 2:3942950-3942972 CAGGCCTCAGAGATGGGAGGAGG - Intergenic
925884422 2:8382221-8382243 CAAGCATCAGGGATGGAAGATGG + Intergenic
927288042 2:21377446-21377468 CTGGCTTCCCAGAAGGAAGGAGG + Intergenic
928937625 2:36695904-36695926 GAGGCTTCTCGAATGGAAGAAGG + Intergenic
929087213 2:38180528-38180550 CAGGCCTCACAGCTGGCATATGG + Intergenic
929960494 2:46492609-46492631 CAGGCATAGCAGATTGAAGAGGG - Intronic
930275712 2:49308797-49308819 CTGGCTTTGAAGATGGAAGAAGG + Intergenic
931135566 2:59395731-59395753 CAGGCTTCACAGAAGGAGCCTGG - Intergenic
932119373 2:69084026-69084048 CAGGCTACAAAGATTGCAGAGGG + Intronic
932645840 2:73500634-73500656 CAGGCTTCAGGAATGAAAGAAGG - Intronic
932975372 2:76593685-76593707 CAGGATTCACAAATGAAAAATGG - Intergenic
933040953 2:77465932-77465954 CAGGCTTCTCAAATGCAATATGG + Intronic
933079844 2:77972259-77972281 ATGGCTTCACAGATGAAAAATGG - Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934508322 2:94915232-94915254 CTGGCTTCAAAGCTGGAAGGAGG - Intergenic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
937921073 2:127131303-127131325 GTGCCTTCACAGATGGCAGAAGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
939655772 2:144822509-144822531 CATGAATCACAAATGGAAGAGGG + Intergenic
940165309 2:150764307-150764329 CTGGCTTCCCAGTTGGAAGGTGG - Intergenic
940843643 2:158615352-158615374 CAGGCTTCATAAATGGCTGAGGG - Intronic
941551928 2:166927524-166927546 CTGGCTTTGAAGATGGAAGAAGG - Intronic
941641030 2:167988616-167988638 AAGCCTTCACCTATGGAAGAAGG - Intronic
941646928 2:168050595-168050617 CTGGCTTTGCAGATGGCAGAAGG + Intronic
942087234 2:172454836-172454858 CTGGCTTTACAGATGAAAGAAGG + Intronic
943538706 2:189184569-189184591 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
944014935 2:195024666-195024688 CATGCTTGACAGTTGGAGGAGGG + Intergenic
944325817 2:198402326-198402348 GATGCTTGACATATGGAAGAAGG + Intronic
944630852 2:201622558-201622580 CTGGCTTTGAAGATGGAAGAGGG - Exonic
944886424 2:204066995-204067017 CAGGCTTCACAGTGGAGAGAAGG + Intergenic
945322016 2:208435556-208435578 CTGACTTCGAAGATGGAAGAAGG + Intronic
945977165 2:216280021-216280043 CTGGCTTCAGAGGTGGTAGAAGG - Intronic
946469488 2:219944973-219944995 CTGGCTTGGCAAATGGAAGATGG + Intergenic
946698109 2:222382274-222382296 CAGGCCTCACAGATGCAAACAGG - Intergenic
946760146 2:222985457-222985479 TAGGCTAAACACATGGAAGATGG + Intergenic
946869330 2:224071783-224071805 AAGGCTGCACAGTGGGAAGAAGG - Intergenic
947457741 2:230270996-230271018 CAGGCTTTGAAGATGGAAGAAGG + Intronic
947468080 2:230372010-230372032 CAGGCTTTGAAGATGGAAGAGGG + Intronic
947859481 2:233348533-233348555 CAGGCTTCTGGGATGGAACATGG + Intergenic
947917076 2:233839593-233839615 CAGGCACCACAGAAGGAACAAGG + Intronic
949073177 2:242039048-242039070 CTGGCTTCACAGATGGGATCTGG + Intergenic
1169133421 20:3180425-3180447 CTGGCTTTGCAGATGGAAGAAGG + Intergenic
1169236576 20:3934430-3934452 GTGGCTTCACACGTGGAAGATGG - Intronic
1169781750 20:9317570-9317592 CATGCTTCAAGGATGCAAGAAGG + Intronic
1170375876 20:15699709-15699731 CAGACGTCACAGGTGGAGGAGGG - Intronic
1170455299 20:16527311-16527333 GAGGCTGCCCAGTTGGAAGATGG + Intronic
1170758394 20:19225604-19225626 CAGGGTTCAGAGATGGAAGAAGG - Intronic
1170856595 20:20061940-20061962 CAGGGTTCAAAAATGGAAGGAGG - Intronic
1171488451 20:25500246-25500268 CAGGCTTCCCAGAGGGATGCAGG - Intronic
1172669786 20:36627080-36627102 CAGGCTTTCCAGATGGAGGGAGG + Intronic
1173013071 20:39200090-39200112 CTGGCCTGACAGATGGAAAAGGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1174128343 20:48325127-48325149 TGGGCTGCACAGCTGGAAGAAGG - Intergenic
1174972308 20:55289818-55289840 CATGCTTCTCAGATAGGAGATGG - Intergenic
1175627087 20:60498106-60498128 CAGGATTCACTGTTGGAAAATGG + Intergenic
1175738880 20:61406620-61406642 CAGGCAGAACAGATGGCAGATGG - Intronic
1175774228 20:61642820-61642842 CTGGCTTCAGAGATGGGGGAAGG - Intronic
1178804101 21:35824162-35824184 CTGGCTTTGCAGATGGAGGAAGG + Intronic
1178977340 21:37231378-37231400 CAGGCTACAGAGGTGGGAGACGG + Intronic
1179164854 21:38927362-38927384 CAGGCTTTGAAGATGGAGGAAGG - Intergenic
1179224223 21:39439195-39439217 CTGGCTTTCAAGATGGAAGAAGG + Intronic
1179255637 21:39713078-39713100 CTTGGTTCACAGATGGCAGATGG - Intergenic
1181760746 22:25057243-25057265 CAGGATCCCCAGGTGGAAGAAGG + Intronic
1182044786 22:27265795-27265817 AAGGCTTCACAGATAGAAGTTGG + Intergenic
1183009100 22:34930202-34930224 CAGGCTTCACAAGTGGGAGGTGG - Intergenic
1183209834 22:36444074-36444096 AAGGTTTCAAAGATGGAGGATGG + Intergenic
1184422190 22:44388764-44388786 CTGGCTTTGGAGATGGAAGAAGG + Intergenic
1184677284 22:46050631-46050653 CTGGCTTTAAAGACGGAAGAAGG - Exonic
1184737788 22:46409435-46409457 CAGGCTTGACAGGAGGCAGACGG + Intronic
1184804185 22:46781818-46781840 CGGGGCTCTCAGATGGAAGAGGG - Intronic
1185149718 22:49157196-49157218 CCGTCTCCACAGCTGGAAGAAGG - Intergenic
1185274341 22:49943885-49943907 CACGCTACCCAGAAGGAAGAAGG + Intergenic
950838335 3:15942116-15942138 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
952198993 3:31105942-31105964 CAGGGATCACAGATTGAGGATGG + Intergenic
952544587 3:34405220-34405242 CATGTTTCACAGATGAATGAAGG - Intergenic
953479547 3:43238576-43238598 CAGGCTTCACTTATGTGAGAGGG + Intergenic
954317204 3:49807580-49807602 CTGGCTTCATAGCAGGAAGAGGG + Intronic
954360872 3:50122215-50122237 CAGGGCTCCCAGATGGAAGCAGG + Intergenic
954861826 3:53696677-53696699 CTGGATTCAAAGATGGGAGAAGG + Intronic
955909805 3:63848257-63848279 CAGGCTTCACAGAGAATAGATGG - Intronic
955979426 3:64509800-64509822 CTGGCTTTGCAGATAGAAGAAGG + Intergenic
956349598 3:68320427-68320449 TGGGCTTCACTGATGGGAGACGG + Intronic
957208981 3:77236334-77236356 CAGGCTTCACAGAGAACAGACGG + Intronic
960406435 3:117265916-117265938 AAGGCTTCAAAGATAGAAGAGGG - Intergenic
960425933 3:117507979-117508001 CAGGCTTTACAGATAATAGATGG + Intergenic
960511319 3:118552874-118552896 CAGGCTTCACCTCTGGAAGTAGG - Intergenic
960636948 3:119793551-119793573 CTGGCTTTGAAGATGGAAGAAGG - Intronic
960790964 3:121430434-121430456 CTGGCTTTAAAGTTGGAAGAAGG - Intergenic
960951615 3:123002225-123002247 CAGGCATCACGGATGGGGGATGG + Intronic
961384928 3:126517934-126517956 CAGGCTTCACAGTGGGGAGGGGG + Intergenic
961543724 3:127617884-127617906 CAGGCTGCTCTGATGGCAGAAGG - Intronic
961577230 3:127847435-127847457 CATGCTTGACAGAGGGAAGGAGG + Intergenic
962041878 3:131715986-131716008 CATTCTTGACAGATGGATGAGGG - Intronic
962088090 3:132212975-132212997 CGGGCTTTAAAGATGGAGGAAGG + Intronic
963380113 3:144518723-144518745 CAAGCTACACAGATGATAGAAGG + Intergenic
963842218 3:150119414-150119436 CAGGCTTCAGAGAGAGTAGACGG - Intergenic
965500080 3:169445815-169445837 CAGGTTACACTGATGCAAGAGGG - Intronic
965551098 3:169966276-169966298 AAGGCTCCACAGGTGGTAGATGG - Intergenic
965658084 3:171011386-171011408 TGTGCTTCAAAGATGGAAGAAGG + Intronic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
967000231 3:185327177-185327199 CTGGCTTCGAAGATGGAGGAAGG - Intronic
968759336 4:2433949-2433971 GAGGCTTCTCAGATGGATGTCGG - Intronic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
968949332 4:3682430-3682452 CAGGCGTCACAGATGAAGGGTGG + Intergenic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969525593 4:7702428-7702450 AAGGCCTCACAGCTGGAAGGTGG - Intronic
969993944 4:11292566-11292588 CTGGCTTCAGAGATGGGACAAGG - Intergenic
970420494 4:15901509-15901531 CTGGCTTTAAAGATGGAAGATGG - Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
971220877 4:24705002-24705024 CTCTCTTCACAGCTGGAAGATGG + Intergenic
971391808 4:26193024-26193046 CTGGCTTTGAAGATGGAAGAAGG + Intronic
974093292 4:57335002-57335024 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
980329771 4:131395586-131395608 TAGGCTTCAGAGATAGTAGATGG - Intergenic
980424248 4:132605960-132605982 CTGGCTTTACAAATGAAAGAAGG + Intergenic
981051252 4:140311597-140311619 CAGGCTTACCAGGAGGAAGAGGG - Intronic
981297263 4:143146640-143146662 CAGGCTTTTCAGCTTGAAGATGG - Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984279334 4:177650141-177650163 CAGGGTTCACAGATGGACATAGG - Intergenic
985220143 4:187695706-187695728 GAGGCCTCACACATGGCAGAAGG - Intergenic
985371788 4:189292704-189292726 CAGGCCACACTGATGCAAGAGGG - Intergenic
985819878 5:2152436-2152458 CTCACTGCACAGATGGAAGATGG + Intergenic
985819881 5:2152471-2152493 CTCACTGCACAGATGGAAGATGG + Intergenic
985819884 5:2152506-2152528 CTCACTGCACAGATGGAAGATGG + Intergenic
985819887 5:2152541-2152563 CTCACTGCACAGATGGAAGATGG + Intergenic
985819890 5:2152576-2152598 CTCACTGCACAGATGGAAGATGG + Intergenic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
987486205 5:18530533-18530555 CAGCCTTCAGGGATGAAAGAGGG - Intergenic
987542281 5:19271080-19271102 CAGGCTTCAGAGATAATAGATGG + Intergenic
987960492 5:24802441-24802463 CTGACTTTAAAGATGGAAGAAGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
992913819 5:81426749-81426771 CTGTCTTAACAGTTGGAAGAGGG - Intronic
993377706 5:87169044-87169066 CAAGCTTCCTAGATAGAAGAGGG - Intergenic
993433494 5:87861922-87861944 CTGGCTTCAAAAATGGAGGAAGG - Intergenic
994076707 5:95659941-95659963 CAGTGTTCAAAGAAGGAAGAGGG - Intronic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
995647021 5:114324465-114324487 CAGGCTTTGAAGATGAAAGAAGG + Intergenic
995722451 5:115151066-115151088 CAGACTCCACAGGTGGGAGAAGG + Intronic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996243627 5:121232749-121232771 CCTGCGTCACAGATGGAAAATGG - Intergenic
997299531 5:132792445-132792467 GACCCTTCACAGATGGATGAGGG - Intronic
998139020 5:139689672-139689694 CAGGCCTCAAAGCTGGAAGAGGG - Intergenic
998700162 5:144689245-144689267 CAGGCTTCAGAGAGAGTAGATGG - Intergenic
998919902 5:147056564-147056586 CAGGGTTCACAGATTGATGAAGG - Intronic
999254384 5:150201942-150201964 CAGGCTGCACAGCTAGAAAATGG + Intronic
999354650 5:150914753-150914775 CAGGCTTTATTGATTGAAGAGGG + Intergenic
999367078 5:151030123-151030145 AAGCCATCACAGATGGGAGAAGG - Exonic
1000959613 5:167584499-167584521 CATGCCTCACAGATGAAAAATGG - Intronic
1001770756 5:174294161-174294183 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1003435376 6:6083170-6083192 CATGCTTCCCAGATGGGAGCTGG - Intergenic
1003601142 6:7518675-7518697 CTGGGTTCCCTGATGGAAGAGGG - Intergenic
1004152681 6:13135169-13135191 CCTGATTCACAGCTGGAAGATGG - Intronic
1004311994 6:14554070-14554092 CAGGCATCACACTTGGAACAGGG - Intergenic
1004873706 6:19934329-19934351 CAGGTTTCACAAATGGCATAAGG - Intergenic
1004888302 6:20072719-20072741 CTGGCTTTGAAGATGGAAGAGGG - Intergenic
1005416475 6:25605242-25605264 CATGCATGACATATGGAAGATGG + Intronic
1005488115 6:26320364-26320386 CAGCCTTCTAAGATGGAGGAAGG + Intergenic
1006010663 6:31040366-31040388 CAAGCTTTGAAGATGGAAGAAGG + Intergenic
1006190542 6:32205150-32205172 CAGGCTTCAAAGAGAGAAAAGGG + Intronic
1007202137 6:40118585-40118607 CAGGCTGCACTTCTGGAAGAAGG - Intergenic
1007252982 6:40509017-40509039 CAGACCTCACAGGTGGAAGGAGG - Intronic
1007702810 6:43774347-43774369 CAGGCTGCACCCATGGCAGAAGG + Exonic
1009443912 6:63716737-63716759 CTGGCTTCAAATATGGAGGAAGG - Intronic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1010968307 6:82237264-82237286 AAGGTTTTACAGATGGAAAAGGG + Intronic
1013423390 6:109987333-109987355 CAGGCTTGACAGGAGGAGGATGG + Intergenic
1013754949 6:113450659-113450681 CAGGCGTCAGAGATGTTAGAAGG - Intergenic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015891922 6:137978047-137978069 CAGACCTCACAGATGGAATGAGG + Intergenic
1015896354 6:138020678-138020700 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1016839941 6:148516179-148516201 CAGGCTTCACAGATGGAAGATGG + Intronic
1018114998 6:160574358-160574380 CAGACTTCACAGGTGGGGGAAGG - Intronic
1018381220 6:163259965-163259987 CTGGTTTCAGAGTTGGAAGAGGG + Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1018801162 6:167223324-167223346 CAGGGCTCACAGATGGTAAAAGG - Intergenic
1020260735 7:6529497-6529519 CCAACTGCACAGATGGAAGAAGG + Intronic
1021219430 7:17958903-17958925 CAGGTTTCACATTTGGAAGAGGG - Intergenic
1021301734 7:18981597-18981619 CTGGCTTTAAAGATGGAAGAAGG - Intronic
1021631764 7:22654592-22654614 CAGTCTTCAGAGAGAGAAGAAGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022155024 7:27652125-27652147 CAGGGTTCTCAGCTGTAAGATGG - Intronic
1023362763 7:39432708-39432730 CACTCTTCCCAGGTGGAAGAGGG + Intronic
1023381509 7:39612870-39612892 CCGGCTTTGGAGATGGAAGAGGG + Intergenic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1024417964 7:49129972-49129994 CTCGCTTCTCAGGTGGAAGAAGG + Intergenic
1024791005 7:52964810-52964832 CTGGCCTCCAAGATGGAAGAAGG + Intergenic
1026188822 7:68105810-68105832 CAGGCTTGACAAATGCAAGGAGG + Intergenic
1026895613 7:74008378-74008400 CAGCCATCTCAGATGGAAGAAGG + Intergenic
1027225552 7:76241401-76241423 CAGGGGTCTCAGATGGAAAAGGG + Intronic
1028032657 7:85935549-85935571 CTGACTTCAAAGATGGAAGAAGG - Intergenic
1028123637 7:87086087-87086109 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1028737714 7:94236285-94236307 TAGGCTTTAAAGATGGAAGTAGG + Intergenic
1029330173 7:99846828-99846850 CAGTTTTGAAAGATGGAAGAAGG + Intronic
1029375746 7:100176105-100176127 GAGTCTTCACAGATGGAGTAAGG + Intronic
1029662345 7:101971091-101971113 CAGTCTCCCCAGATGGAAAATGG - Intronic
1029957775 7:104657729-104657751 GAAGCTCCAGAGATGGAAGATGG - Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1031013728 7:116550247-116550269 CAGGGTTTCAAGATGGAAGAGGG - Intronic
1032123581 7:129174564-129174586 CAGGCTTGGAAGATGGAGGATGG - Intergenic
1032860885 7:135878245-135878267 CAGCCTTCTCAGATGGAAAAGGG - Intergenic
1034740413 7:153468200-153468222 TAGGCTTCATTGATGGCAGAGGG + Intergenic
1035596195 8:859837-859859 CAGGCAGCCGAGATGGAAGACGG + Intergenic
1035777111 8:2196557-2196579 CAGGCTTCTCAGCTTGCAGACGG - Intergenic
1038030855 8:23638024-23638046 CTGGCTTTAAAGATGGAGGAAGG + Intergenic
1038097697 8:24333720-24333742 GTGGCTTCAAAGATTGAAGATGG - Intronic
1038403949 8:27308060-27308082 CACACTTCAGAGCTGGAAGAAGG + Intronic
1039258800 8:35748508-35748530 GAGGCTTCACAGTTGAAAAAAGG - Exonic
1039997925 8:42550530-42550552 CTGGCTTTGCAGATGGAGGAAGG - Intronic
1041709553 8:60881447-60881469 CAGGCTTTGCAGATGGAGGAAGG - Intergenic
1042484668 8:69336905-69336927 CTGGCTTCACAGATGGGATCTGG + Intergenic
1042985610 8:74579810-74579832 CAGGCTTTACAACTGGAAAATGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1045089462 8:98726060-98726082 CAGGCTTCTGACAGGGAAGAAGG + Intronic
1046704258 8:117433392-117433414 CTGGCTTTGCAGATGGAGGAAGG - Intergenic
1047179869 8:122576779-122576801 CTGGATTCAGAGATGGAAGGGGG - Intergenic
1047643294 8:126843804-126843826 CAGTTTGCACAGATGGAAGCAGG - Intergenic
1047902274 8:129436321-129436343 CTGGCTTTAAAGATGGAAGAAGG + Intergenic
1048402105 8:134081782-134081804 CATGCCTCACAGATGGGAGATGG - Intergenic
1048946731 8:139455660-139455682 CAGCCTTCATGGAGGGAAGATGG - Intergenic
1049758704 8:144322168-144322190 CATACTGCACAGGTGGAAGAGGG + Intronic
1050248126 9:3713410-3713432 AAGACGTCACAGAAGGAAGACGG + Intergenic
1050810187 9:9735731-9735753 CTGGCTTCAAAGATGTAAAACGG + Intronic
1051018658 9:12513678-12513700 CAGGCTTCAGATATAGAAGAAGG - Intergenic
1051111040 9:13637036-13637058 CTGGCTTTACAGATGGAATGGGG + Intergenic
1051419810 9:16877815-16877837 CAGGCTTTGAAGATGGAAGGGGG - Intergenic
1051718231 9:20008195-20008217 CAGGCTTAAGAGAGGGAAGAGGG - Intergenic
1051741747 9:20259084-20259106 CTGGCTTCCAAGATGGAGGAAGG + Intergenic
1053406783 9:37883920-37883942 CATCCTTTACAGCTGGAAGAAGG + Intronic
1053469666 9:38337280-38337302 CTGACTTCATAGATGGCAGAAGG + Intergenic
1055805527 9:80088869-80088891 CAGGCCACAGAGATGGAAGCGGG + Intergenic
1056310520 9:85336157-85336179 CAGGCTTATCAGAATGAAGAAGG + Intergenic
1056542807 9:87588546-87588568 CAGCTTTCACAGATGGCAAATGG + Intronic
1056713667 9:89011069-89011091 CAGGCTTCAGACATAGCAGATGG - Intergenic
1058910412 9:109515673-109515695 AAGGCTTCACTTATGGCAGAAGG + Intergenic
1059928711 9:119239634-119239656 AAGGTTTCACAGCTGGAAAAGGG - Intronic
1060547747 9:124470830-124470852 CAGCCTTCCCAGCTGGCAGAGGG - Intronic
1061615943 9:131779007-131779029 CTGGCTTCAGAGATGGAAGAAGG + Intergenic
1062426877 9:136510212-136510234 CAGGCTTCACAGACCGAGCAGGG + Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185540167 X:897020-897042 CTGGCTTCGAAGATGGAGGAAGG - Intergenic
1185823231 X:3224874-3224896 CAGGGTTCACAGAAGGAATGAGG + Intergenic
1186169813 X:6864724-6864746 CTGGCTTCAAAGATGGAAGGAGG - Intergenic
1186398554 X:9235122-9235144 CAGCCTTCATGGAAGGAAGAAGG - Intergenic
1186437649 X:9556871-9556893 CTGGCTTTAAAGATGGAGGAAGG - Intronic
1186621912 X:11250621-11250643 CCGGCTTCAAAGATGGAGAAAGG - Intronic
1186622880 X:11260113-11260135 CTAGCTTTACAGATGGAAAAAGG + Intronic
1187111257 X:16302966-16302988 CAGGCTTTGAAGATGGAAGAAGG + Intergenic
1187448968 X:19380474-19380496 ATGGCTTCACAAATGGCAGATGG + Intronic
1188508173 X:30906069-30906091 CAGGCTTCAGAGAGAGTAGATGG - Intronic
1190879338 X:54481846-54481868 AAGGCTCCACAGCAGGAAGAAGG + Intronic
1191783461 X:64892919-64892941 CAGGCTTCTTAGATGGCATATGG + Intergenic
1192259210 X:69494128-69494150 CAGACTTCAGAGAAGAAAGAGGG + Intergenic
1192791324 X:74384224-74384246 CAGGCTCCACATATGCAGGAAGG + Intergenic
1193809895 X:86039034-86039056 CAGGCTTCACATTTGAAAAATGG + Intronic
1193866472 X:86737982-86738004 CTGGCTTTGAAGATGGAAGAAGG - Intronic
1194871538 X:99138540-99138562 CAGGCTTCATTGATGGTAGCAGG + Intergenic
1196009327 X:110870332-110870354 CAGGATTGACAGATGGCATAGGG + Intergenic
1196560083 X:117135754-117135776 CTGGCTTTGAAGATGGAAGATGG + Intergenic
1196745616 X:119069586-119069608 CTGGCTTTAAAGATGGAGGAAGG - Intergenic
1197551851 X:127901363-127901385 CTGTCTTCACAGGTGGCAGATGG + Intergenic
1198057336 X:133008057-133008079 CTGGCTTCAAATATGGAGGATGG - Intergenic
1198953274 X:142097587-142097609 CTGGCTTTGAAGATGGAAGAAGG - Intergenic
1199235664 X:145489306-145489328 CTGGTTTCACTGATGGCAGAAGG + Intergenic
1199763815 X:150926035-150926057 CTGGCTTTGCAGATGGAGGAAGG + Intergenic
1199973339 X:152876630-152876652 TGTGCTTCAAAGATGGAAGAAGG - Intergenic
1200181297 X:154152100-154152122 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200186943 X:154189214-154189236 CAGGCTTCCCAGATGGCCAAGGG - Intergenic
1200192593 X:154226352-154226374 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200198348 X:154264156-154264178 CAGGCTTCCCAGATGGCCAAGGG - Intronic
1200291330 X:154877406-154877428 CTGGCTTCGAAGATGGAGGAAGG + Intronic
1201560159 Y:15307294-15307316 CTGGCTTCAAAGATAGAAGAAGG - Intergenic