ID: 1016844401

View in Genome Browser
Species Human (GRCh38)
Location 6:148556707-148556729
Sequence CCAAGGGTGCTGAGAGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016844401_1016844408 14 Left 1016844401 6:148556707-148556729 CCACTGCCTCTCAGCACCCTTGG No data
Right 1016844408 6:148556744-148556766 GCCCACCCTTTGAATGTTCAGGG No data
1016844401_1016844410 15 Left 1016844401 6:148556707-148556729 CCACTGCCTCTCAGCACCCTTGG No data
Right 1016844410 6:148556745-148556767 CCCACCCTTTGAATGTTCAGGGG No data
1016844401_1016844407 13 Left 1016844401 6:148556707-148556729 CCACTGCCTCTCAGCACCCTTGG No data
Right 1016844407 6:148556743-148556765 TGCCCACCCTTTGAATGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016844401 Original CRISPR CCAAGGGTGCTGAGAGGCAG TGG (reversed) Intergenic
No off target data available for this crispr