ID: 1016845362

View in Genome Browser
Species Human (GRCh38)
Location 6:148563529-148563551
Sequence GAGCTATTCCAGAGGACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016845362_1016845365 10 Left 1016845362 6:148563529-148563551 CCCTTTGTCCTCTGGAATAGCTC No data
Right 1016845365 6:148563562-148563584 CATTTCACCCACTTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016845362 Original CRISPR GAGCTATTCCAGAGGACAAA GGG (reversed) Intergenic
No off target data available for this crispr