ID: 1016845641

View in Genome Browser
Species Human (GRCh38)
Location 6:148565627-148565649
Sequence ACTCACCCACTTCTAAGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016845637_1016845641 0 Left 1016845637 6:148565604-148565626 CCTTCATTCATCGCCAGATACTA No data
Right 1016845641 6:148565627-148565649 ACTCACCCACTTCTAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016845641 Original CRISPR ACTCACCCACTTCTAAGGGA TGG Intergenic
No off target data available for this crispr