ID: 1016847028

View in Genome Browser
Species Human (GRCh38)
Location 6:148578702-148578724
Sequence GACTCAGGATTAGGTCCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016847028_1016847031 -6 Left 1016847028 6:148578702-148578724 CCATGTGGACCTAATCCTGAGTC No data
Right 1016847031 6:148578719-148578741 TGAGTCATAGATTGTCTACCTGG No data
1016847028_1016847032 -5 Left 1016847028 6:148578702-148578724 CCATGTGGACCTAATCCTGAGTC No data
Right 1016847032 6:148578720-148578742 GAGTCATAGATTGTCTACCTGGG No data
1016847028_1016847033 -4 Left 1016847028 6:148578702-148578724 CCATGTGGACCTAATCCTGAGTC No data
Right 1016847033 6:148578721-148578743 AGTCATAGATTGTCTACCTGGGG No data
1016847028_1016847034 5 Left 1016847028 6:148578702-148578724 CCATGTGGACCTAATCCTGAGTC No data
Right 1016847034 6:148578730-148578752 TTGTCTACCTGGGGTCAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016847028 Original CRISPR GACTCAGGATTAGGTCCACA TGG (reversed) Intergenic
No off target data available for this crispr