ID: 1016854464

View in Genome Browser
Species Human (GRCh38)
Location 6:148652668-148652690
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 10, 1: 18, 2: 23, 3: 35, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016854459_1016854464 15 Left 1016854459 6:148652630-148652652 CCAGCTTAATTAAAAGTGAATAT No data
Right 1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG 0: 10
1: 18
2: 23
3: 35
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016854464 Original CRISPR CTGGACTCCTTGGGAAAAAC AGG Intergenic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900543059 1:3213669-3213691 CTGGAATCCTGGGGAAATGCTGG - Intronic
905183502 1:36180233-36180255 AAGGACTTCTGGGGAAAAACAGG - Exonic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909210435 1:72816213-72816235 CTAGACTTCTTAGGAAAAACAGG - Intergenic
912687639 1:111779667-111779689 CTGGACTCCCTGAGAACCACAGG + Intronic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915297502 1:154931560-154931582 CTGCACTGCATGGGAAAGACAGG - Intronic
917033118 1:170716934-170716956 CTGCATTCTTGGGGAAAAACAGG + Intronic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
917401725 1:174656834-174656856 CAGAACTCCTTGGCAAAGACTGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921077158 1:211709077-211709099 CTGGACCCCTTGGGAAAAGCAGG + Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
921930488 1:220750263-220750285 CTGGACACCTTCCAAAAAACTGG + Intronic
921959803 1:221022710-221022732 CTGGCATCCTAGGGTAAAACAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
922912880 1:229232249-229232271 CTGGACAGCTTGGGGAAAATGGG + Intergenic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1067192247 10:44081557-44081579 CTTGACTGCTTGGGGACAACAGG + Intergenic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1072424167 10:95315337-95315359 CTGGGTTCCTTCTGAAAAACAGG - Intronic
1072489729 10:95892755-95892777 CTGGACTGCTTAGGGCAAACCGG - Intronic
1074424935 10:113342426-113342448 CTGGTCTCCTGGGGAAACAGTGG + Intergenic
1074862817 10:117525152-117525174 CTGGATCTCTTGGGTAAAACTGG - Intergenic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1078724134 11:13913439-13913461 CTGGTCTCCTTGAGAGAAATTGG - Intergenic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084440688 11:69171076-69171098 CTGCACTTTGTGGGAAAAACAGG + Intergenic
1084617194 11:70244412-70244434 CTTGAGCCCTTGGGAAAAGCAGG - Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088030282 11:105240367-105240389 CTGAACTCCTTGGGAAAATTTGG + Intergenic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1088930545 11:114347155-114347177 CTGGACTCCTTGGGTCAATAGGG - Intergenic
1089328892 11:117676509-117676531 CTGGACCCTTTGGGAAAAAGAGG - Intronic
1090978517 11:131695969-131695991 CTGGAGTGCATGAGAAAAACTGG + Intronic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094233938 12:28141033-28141055 CTAGACTCTATGGGAAAGACAGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1094595541 12:31862852-31862874 CCGGAGTCCTTGGGATATACAGG - Intergenic
1094741607 12:33296160-33296182 ATGGACTCCTTGAGAAATACAGG + Intergenic
1095172683 12:39054632-39054654 CTGGGCACCTTGAAAAAAACAGG + Intergenic
1096475862 12:51908271-51908293 CTGGCCTCCATGGAAAAATCTGG - Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1098512635 12:71335899-71335921 TTGGACTAACTGGGAAAAACAGG - Intronic
1100169157 12:91953427-91953449 CTGGATTCATTGGTAAACACAGG - Intergenic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101933684 12:109037750-109037772 CGGCACTCCTTGGCAAAGACTGG - Intronic
1105026136 12:132850392-132850414 TTGGATTCCTGGGGAAAAGCTGG + Intronic
1106460673 13:29964897-29964919 CTGGAACCCTTGGGGAAAGCAGG - Intergenic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1110049900 13:70883730-70883752 CCTGACTCCTTGGTAAAAACAGG + Intergenic
1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG + Intergenic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1113881388 13:113628707-113628729 CTGGGCCCCTAGGGAAAAAAAGG - Intronic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116626592 14:47272591-47272613 CTGGAGTACTAGGGAAAAAGTGG - Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116763006 14:49038209-49038231 CTGGATCCCTAGGGAAAGACTGG + Intergenic
1116793680 14:49366558-49366580 CTCAAGTCCTTGAGAAAAACAGG - Intergenic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120865763 14:89294081-89294103 CAGGAGCCCTTGGGAAGAACGGG - Intronic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121429769 14:93878631-93878653 CTGGGTCCCTGGGGAAAAACAGG + Intergenic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1122940046 14:104977182-104977204 CCCCACTCCTTGGGGAAAACAGG - Intronic
1123170873 14:106371736-106371758 CTGGACTCATGGAGAAAAAAAGG - Intergenic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1124949269 15:34301510-34301532 CTAGACTTGTTGGGAAAAATTGG - Intronic
1125878297 15:43168778-43168800 CTGCAGTCCTTGGGCAAATCTGG - Intronic
1126238155 15:46409737-46409759 CTGAAGACCTTGGGAAACACAGG - Intergenic
1128723685 15:69972119-69972141 CTGGCCTGCTTGGTCAAAACAGG + Intergenic
1128805861 15:70530833-70530855 CTGGACACCTAGTGATAAACAGG + Intergenic
1131439449 15:92447955-92447977 CTGGAGTCCTTGGGGATAAGAGG + Intronic
1131557163 15:93409810-93409832 CTTGACTCTTTGTGAAAAGCTGG + Intergenic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1139348423 16:66320101-66320123 CCAGAATCCTCGGGAAAAACTGG + Intergenic
1143152632 17:4816877-4816899 CTGGACTCCTTGGGACACTTGGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1150030575 17:61730162-61730184 CTTTAATCCTAGGGAAAAACAGG + Intronic
1154273771 18:12942188-12942210 CTAAAATCCTTGGGACAAACTGG + Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1156999930 18:43511723-43511745 CTGGTCTGCTTGGGAAAAGATGG + Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1157280895 18:46345600-46345622 CTTGACTCCTAGGGCAAAACAGG + Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1158149987 18:54357534-54357556 CTGAACTCACTTGGAAAAACTGG + Intronic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1162796597 19:13090473-13090495 CTGGAGTCCTTGGGGCTAACAGG + Intronic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1163572950 19:18093582-18093604 CTGGAATCCTGGGGAAAGAGAGG - Intronic
1164903111 19:31945048-31945070 TTTGTCTCCTTGGGAGAAACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166432225 19:42737464-42737486 ATGGACACTTTGGGAAACACAGG + Intronic
1166435340 19:42762653-42762675 ATGGACACTTTGGGAAACACAGG + Intronic
1166445209 19:42852684-42852706 ATGGACACTTTGGGAAACACAGG + Intronic
1166471010 19:43079611-43079633 ATGGACACTTTGGGAAACACAGG + Intronic
1166491769 19:43266523-43266545 ATGGACACTTTGGGAAACACAGG + Intronic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1167430829 19:49453474-49453496 CGGGACTCCCCGCGAAAAACCGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
928224738 2:29438906-29438928 CTGGAGCCCTAGGGAAGAACTGG - Intronic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
929945810 2:46370961-46370983 GTGGGCTCCTTGGGAACAAGGGG + Intronic
930859910 2:56060894-56060916 AAGGACTCCTTTGGGAAAACCGG - Intergenic
932077873 2:68681990-68682012 CTGGAAATCTTGAGAAAAACGGG + Intronic
932965895 2:76474217-76474239 CTGGATGCCTTGGGAAAAACAGG + Intergenic
933614278 2:84468399-84468421 CTGGACTCCTTGGGGTAAACAGG - Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
934913198 2:98277506-98277528 CTTGACTGCTTTGGAAAATCTGG + Intronic
939442521 2:142267803-142267825 ATAGACTCCTTGGCAAAAATAGG + Intergenic
939722207 2:145667878-145667900 CTGGAGGACCTGGGAAAAACGGG - Intergenic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
941598530 2:167508995-167509017 CTTGACTCTTTGGGAACAAAAGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
943399226 2:187384335-187384357 ATGGACTTTTTGGGAAGAACAGG - Intronic
943515373 2:188879558-188879580 GTGGACTCCTTGAGAAAATGAGG + Intergenic
944110455 2:196125908-196125930 CTGGACACAATTGGAAAAACTGG - Intergenic
945574367 2:211512105-211512127 CAGACATCCTTGGGAAAAACTGG + Intronic
945912096 2:215661158-215661180 GTAGAGCCCTTGGGAAAAACAGG + Intergenic
948278734 2:236730147-236730169 GTGGACTCTGTGGGGAAAACAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
1168896710 20:1328715-1328737 GTGGATTCCTTGGGAGAAATGGG + Intronic
1170930318 20:20763861-20763883 CTGGGCTCCTTGGGAGAACTGGG + Intergenic
1173047526 20:39526774-39526796 TTGGACTCTTTGAGAATAACAGG + Intergenic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1181049502 22:20231877-20231899 CTGGACACCTGTGGAAAGACAGG - Intergenic
1181340068 22:22171705-22171727 CTGGACCTGTTGAGAAAAACAGG - Intergenic
1182020140 22:27074871-27074893 CTGGAGTCATAGGGAGAAACTGG + Intergenic
1182677749 22:32053086-32053108 CTGGACTCCTTGGTAAAGTTTGG + Intronic
1183359991 22:37378525-37378547 CTGGACTGTTTGGGAAGAGCTGG - Intronic
949220156 3:1623188-1623210 CTGGACTGCTTTAGGAAAACAGG + Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951210261 3:19966917-19966939 CTGGACTACTTGGGAGGTACAGG - Intronic
956629645 3:71303466-71303488 CTGTACTCATTTGCAAAAACTGG + Intronic
957244402 3:77699800-77699822 CTGGATTCCTTTAGAAGAACTGG + Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
960235950 3:115282333-115282355 TTGGGCTCCTGTGGAAAAACAGG + Intergenic
960584268 3:119306225-119306247 TTGGACTCCTTGAGACAAAATGG + Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962493049 3:135911954-135911976 CAGGGATCCTTGAGAAAAACAGG - Intergenic
962834857 3:139181135-139181157 CTGGAGTCCTTGGGAAGTATGGG + Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967220104 3:187241524-187241546 CCAGACTCCTTGGGCAGAACAGG + Exonic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
968476852 4:814686-814708 CCGGACTCCTGGGGAAAACCTGG - Intronic
968661074 4:1799045-1799067 CCGGAGTCCTTGGGACAGACTGG + Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971944150 4:33252308-33252330 CAGGACACAATGGGAAAAACTGG - Intergenic
972618041 4:40719112-40719134 CTGGACTCCCTGTGTAACACAGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
974169650 4:58250210-58250232 CTGGACTCCTTGAGAGACAGGGG - Intergenic
975075177 4:70198072-70198094 CTGGGCTCCTTGGGCAAAACTGG - Exonic
976638684 4:87313889-87313911 CTTCAGGCCTTGGGAAAAACTGG - Exonic
976984529 4:91276747-91276769 TTGGACACAATGGGAAAAACTGG - Intronic
977621435 4:99142154-99142176 CTGGTCAGCTTGGGAAAAATGGG + Intronic
980073316 4:128265977-128265999 CTGGGCACCTTGAAAAAAACAGG - Intergenic
981836194 4:149057281-149057303 CTGAACTCTTTGGGAATAAGAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
986092457 5:4523601-4523623 CAGGCATCCTTGAGAAAAACAGG + Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1006819465 6:36880266-36880288 CTGGAATCCATGGGAAAAACAGG + Intronic
1007652470 6:43432127-43432149 CTGGACTCCTGGGGACAAGGGGG - Exonic
1007762541 6:44141474-44141496 CTGGACTCCTTGGAATCCACTGG - Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010823727 6:80447614-80447636 ATGGATTCCTTGGGACAAAAGGG - Intergenic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016796134 6:148119566-148119588 CTGGGCTCTTTGGAAAAAACAGG + Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017143107 6:151209686-151209708 CTGGGCTCCTTGGGAAATGGAGG - Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018699219 6:166413304-166413326 CTGGACTCATTTGGAGGAACAGG + Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020462052 7:8437112-8437134 CAGGACACCTTGGGGTAAACAGG + Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1023762642 7:43480903-43480925 CAGGACTCCTTCTGAAAAAGTGG - Intronic
1024090425 7:45935234-45935256 CTGCATTCCATGGGAAAGACAGG + Intergenic
1025157647 7:56623776-56623798 AAGCACCCCTTGGGAAAAACTGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG + Intergenic
1028005568 7:85562178-85562200 CTTGACTCATTGGTGAAAACTGG - Intergenic
1029703198 7:102261160-102261182 CTGAACTTCTTGGAAAAGACAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1031742892 7:125456450-125456472 CTGGACTTATTGGGAAAAACAGG - Intergenic
1032081976 7:128863786-128863808 CTGGACTGTTTGGGGGAAACAGG - Intronic
1032891883 7:136205492-136205514 CTGGATACCTAGGGAAAAGCTGG + Intergenic
1034020756 7:147639754-147639776 CTAGACTTCTTGAGACAAACAGG - Intronic
1034566281 7:151918217-151918239 CTGGACTGCTTGGGCACAGCTGG + Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040456850 8:47606702-47606724 CTAGACTCCTTTTGAAAAGCTGG + Intronic
1040999029 8:53431465-53431487 CTGGAGTGCTTGGGAAAATGTGG - Intergenic
1041738902 8:61138650-61138672 CTGGACTCCTGGGGACCCACTGG - Intronic
1043309843 8:78844408-78844430 CTGAACTCCTTGGGAAGCAGAGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044266518 8:90188526-90188548 CTGAAATTCTTGGAAAAAACAGG + Intergenic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1047882155 8:129206891-129206913 ATGGAATCCTGGAGAAAAACTGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048330951 8:133470586-133470608 CTGAGCTCCTTGGGAAGCACGGG + Intronic
1048643048 8:136385979-136386001 CTGGACTAATAGGGAAAAATGGG + Intergenic
1049279611 8:141737588-141737610 CTGAACTCCGTGGGACCAACAGG - Intergenic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049521362 8:143092976-143092998 CTGGATCCCTTAGGAAAAGCAGG + Intergenic
1049629213 8:143643244-143643266 CTGGAGGCCCTGGGGAAAACTGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052998471 9:34564411-34564433 CTGGACTCAGTGGGTAAGACTGG + Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058895511 9:109397457-109397479 GTGGGCTCTTTGGGAAAAATGGG - Intronic
1060681576 9:125569638-125569660 ACAGCCTCCTTGGGAAAAACAGG + Intronic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1195432005 X:104799386-104799408 CTGGAGGCCTTGTGAAAACCTGG + Intronic
1198142183 X:133815335-133815357 CAGGACTCCTGGGGAAAGATAGG - Intronic
1198142400 X:133817616-133817638 CAGGACTCCTGGGGAAAGATAGG + Intronic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1200249524 X:154545448-154545470 ATGGACTTCTTGGGGAAAACAGG - Intronic
1201550773 Y:15214358-15214380 CTGGACTCCTAGGGCAATCCAGG - Intergenic
1201919830 Y:19222269-19222291 CTGGACTTCTTGGGTCAAATAGG + Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic