ID: 1016854702

View in Genome Browser
Species Human (GRCh38)
Location 6:148655577-148655599
Sequence ATGATGTCCTAGAAGAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016854702_1016854705 15 Left 1016854702 6:148655577-148655599 CCTTCACTCTTCTAGGACATCAT No data
Right 1016854705 6:148655615-148655637 TCTGTTATTTTGAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016854702 Original CRISPR ATGATGTCCTAGAAGAGTGA AGG (reversed) Intergenic
No off target data available for this crispr