ID: 1016854705

View in Genome Browser
Species Human (GRCh38)
Location 6:148655615-148655637
Sequence TCTGTTATTTTGAATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1016854700_1016854705 23 Left 1016854700 6:148655569-148655591 CCAGGTGGCCTTCACTCTTCTAG No data
Right 1016854705 6:148655615-148655637 TCTGTTATTTTGAATAAAAGAGG No data
1016854702_1016854705 15 Left 1016854702 6:148655577-148655599 CCTTCACTCTTCTAGGACATCAT No data
Right 1016854705 6:148655615-148655637 TCTGTTATTTTGAATAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1016854705 Original CRISPR TCTGTTATTTTGAATAAAAG AGG Intergenic
No off target data available for this crispr